Mutants (Isolated)

tm949

Allele Nametm949
Sequence NameC49H3.1
CGC Namegcy-8
Worm BaseAllele Name tm949
CGC Name gcy-8
Sequence C49H3.1
Phenotypehomozygous viable
Mutation site35489/35490-35940/35941 (451 bp deletion)
ChromosomeIV
Putative gene structurejoin(35073..35812, 36048..36263, 36311..36533, 36717..37160)
Map position3.5
Balancer
Map position of balancer
Sequence of primersIntRev:CTGCCTGCTATCAAACCTTA,ExtRev:TCATTGTCTAGCAACTGCCT,IntFwd:GCCGCACTTATCCTCTTATT,ExtFwd:ATTATCATTGGAGCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wasserman SM, Beverly M, Bell HW, Sengupta P.
Regulation of response properties and operating range of the AFD thermosensory neurons by cGMP signaling.
Curr. Biol. 2011 21(5) 353-62 
[ PubMed ID = 21315599 ] [ RRC reference ]

Sun LO, Barres BA.
Glia Get Neurons in Shape.
Cell 2016 165(4) 775-6 
[ PubMed ID = 27153490 ] [ RRC reference ]

Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S.
A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC.
Cell. 2016 165(4) 936-48. 
[ PubMed ID = -1 ] [ RRC reference ]