| Allele Name | tm949 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C49H3.1 |
| Gene Name | gcy-8 |
| Worm Base | Allele Name |
tm949
|
| Gene Name |
gcy-8
|
| Sequence |
C49H3.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 35489/35490-35940/35941 (451 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(35073..35812, 36048..36263, 36311..36533, 36717..37160) |
| Map position | 3.5 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CTGCCTGCTATCAAACCTTA,ExtRev:TCATTGTCTAGCAACTGCCT,IntFwd:GCCGCACTTATCCTCTTATT,ExtFwd:ATTATCATTGGAGCCGCACT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Huang TT, Matsuyama HJ, Tsukada Y, Singhvi A, Syu RT, Lu Y, Shaham S, Mori I, Pan CL. Age-dependent changes in response property and morphology of a thermosensory neuron and thermotaxis behavior in Caenorhabditis elegans. Aging Cell 2020 19(5) e13146
[ PubMed ID = 32307902 ]
[ RRC reference ]
|
Sun LO, Barres BA. Glia Get Neurons in Shape. Cell 2016 165(4) 775-6
[ PubMed ID = 27153490 ]
[ RRC reference ]
|
Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S. A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC. Cell 2016 165(4) 936-48
[ PubMed ID = 27062922 ]
[ RRC reference ]
|
Wasserman SM, Beverly M, Bell HW, Sengupta P. Regulation of response properties and operating range of the AFD thermosensory neurons by cGMP signaling. Curr Biol 2011 21(5) 353-62
[ PubMed ID = 21315599 ]
[ RRC reference ]
|
|