| Allele Name | tm949 |
| Sequence Name | C49H3.1 |
| CGC Name | gcy-8 |
| Worm Base | Allele Name |
tm949
|
| CGC Name |
gcy-8
|
| Sequence |
C49H3.1
|
| Phenotype | homozygous viable |
| Mutation site | 35489/35490-35940/35941 (451 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(35073..35812, 36048..36263, 36311..36533, 36717..37160) |
| Map position | 3.5 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CTGCCTGCTATCAAACCTTA,ExtRev:TCATTGTCTAGCAACTGCCT,IntFwd:GCCGCACTTATCCTCTTATT,ExtFwd:ATTATCATTGGAGCCGCACT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wasserman SM, Beverly M, Bell HW, Sengupta P.
Regulation of response properties and operating range of the AFD thermosensory neurons by cGMP signaling.
Curr. Biol. 2011 21(5) 353-62
[ PubMed ID = 21315599 ]
[ RRC reference ]
|
Sun LO, Barres BA.
Glia Get Neurons in Shape.
Cell 2016 165(4) 775-6
[ PubMed ID = 27153490 ]
[ RRC reference ]
|
Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S.
A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC.
Cell. 2016 165(4) 936-48.
[ PubMed ID = -1 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.