分離済み変異体

tm949

Allele Nametm949
BalanceNot Required
OutCrossNot Accepted
Sequence NameC49H3.1
Gene Namegcy-8
Worm BaseAllele Name tm949
Gene Name gcy-8
Sequence C49H3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 35489/35490-35940/35941 (451 bp deletion)
ChromosomeIV
Putative gene structurejoin(35073..35812, 36048..36263, 36311..36533, 36717..37160)
Map position3.5
Balancer
Map position of balancer
Sequence of primersIntRev:CTGCCTGCTATCAAACCTTA,ExtRev:TCATTGTCTAGCAACTGCCT,IntFwd:GCCGCACTTATCCTCTTATT,ExtFwd:ATTATCATTGGAGCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang TT, Matsuyama HJ, Tsukada Y, Singhvi A, Syu RT, Lu Y, Shaham S, Mori I, Pan CL.
Age-dependent changes in response property and morphology of a thermosensory neuron and thermotaxis behavior in Caenorhabditis elegans.
Aging Cell 2020 19(5) e13146 
[ PubMed ID = 32307902 ] [ RRC reference ]

Sun LO, Barres BA.
Glia Get Neurons in Shape.
Cell 2016 165(4) 775-6 
[ PubMed ID = 27153490 ] [ RRC reference ]

Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S.
A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC.
Cell 2016 165(4) 936-48 
[ PubMed ID = 27062922 ] [ RRC reference ]

Wasserman SM, Beverly M, Bell HW, Sengupta P.
Regulation of response properties and operating range of the AFD thermosensory neurons by cGMP signaling.
Curr Biol 2011 21(5) 353-62 
[ PubMed ID = 21315599 ] [ RRC reference ]