分離済み変異体

tm918

Allele Nametm918
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0432.2
Gene Namedjr-1.1
Worm BaseAllele Name tm918
Gene Name djr-1.1
Sequence B0432.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. S. McIntire: normal locomotion.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 33128/33129-33953/33954 (825 bp deletion)
ChromosomeII
Putative gene structurejoin(33249..33380, 33574..33847, 34214..34371)
Map position-15.65
Balancer
Map position of balancer
Sequence of primersIntFwd:CAGAGCTTGTTGTACCGAAT,ExtRev:TATGTCCTCGTTACTCGGGT,IntRev:GGTGACTGCTGTCATTGGAT,ExtFwd:CGGTGAAAGAGATGCGATCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Cooper JF, Machiela E, Dues DJ, Spielbauer KK, Senchuk MM, Van Raamsdonk JM.
Activation of the mitochondrial unfolded protein response promotes longevity and dopamine neuron survival in Parkinson's disease models.
Sci Rep 2017 7(1) 16441 
[ PubMed ID = 29180793 ] [ RRC reference ]

Kamal M, D'Amora DR, Kubiseski TJ.
Loss of hif-1 promotes resistance to the exogenous mitochondrial stressor ethidium bromide in Caenorhabditis elegans.
BMC Cell Biol 2016 17 Suppl 1(1) 34 
[ PubMed ID = 27618966 ] [ RRC reference ]

Chen P, DeWitt MR, Bornhorst J, Soares FA, Mukhopadhyay S, Bowman AB, Aschner M.
Age- and manganese-dependent modulation of dopaminergic phenotypes in a C. elegans DJ-1 genetic model of Parkinson's disease.
Metallomics 2015 7(2) 289-98 
[ PubMed ID = 25531510 ] [ RRC reference ]

Bornhorst J, Chakraborty S, Meyer S, Lohren H, Brinkhaus SG, Knight AL, Caldwell KA, Caldwell GA, Karst U, Schwerdtle T, Bowman A, Aschner M.
The effects of pdr1, djr1.1 and pink1 loss in manganese-induced toxicity and the role of α-synuclein in C. elegans.
Metallomics 2014 6(3) 476-90 
[ PubMed ID = 24452053 ] [ RRC reference ]

Lee JY, Kim C, Kim J, Park C.
DJR-1.2 of Caenorhabditis elegans is induced by DAF-16 in the dauer state.
Gene 2013 524(2) 373-6 
[ PubMed ID = 23624124 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS One 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]

Lee JY, Song J, Kwon K, Jang S, Kim C, Baek K, Kim J, Park C.
Human DJ-1 and its homologs are novel glyoxalases.
Hum Mol Genet 2012 21(14) 3215-25 
[ PubMed ID = 22523093 ] [ RRC reference ]

Cornejo Castro EM, Waak J, Weber SS, Fiesel FC, Oberhettinger P, Schütz M, Autenrieth IB, Springer W, Kahle PJ.
Parkinson's disease-associated DJ-1 modulates innate immunity signaling in Caenorhabditis elegans.
J Neural Transm (Vienna) 2010 117(5) 599-604 
[ PubMed ID = 20376509 ] [ RRC reference ]