Mutants (Isolated)

tm901

Allele Nametm901
Sequence NameF52E1.4
CGC Namegcy-7
Worm BaseAllele Name tm901
CGC Name gcy-7
Sequence F52E1.4
Phenotypehomozygous viable. Dr. G. Jansen, Dr. O. Hobert: WT avoidance of 0.5 M NaCl and WT chemotaxis to NaCl. Dr. Y. Iino: fertile, normal locomotion, normal chemotaxis to KCl.
Mutation site8808/8809-CCTTTNAATTT-9339/9340 (531 bp deletion + 11 bp insertion)
ChromosomeV
Putative gene structurejoin(7958..8005, 8054..8244, 8355..8464, 8540..8787, 8831..8942, 8988..9113, 9157..9269, 9359..9478, 9579..9842, 9895..9996, 10043..10222, 10272..10484, 10532..10651, 10697..10753, 10801..10945, 11129..11367, 11411..11646, 11992..12184, 12229..12502, 12625..12812, 12870..12926)
Map position1.37
Balancer
Map position of balancer
Sequence of primersIntRev:CTAATCTTGGTCGGTACGCA,ExtFwd:CGTCATCATTGGGCCCACTA,ExtRev:CTGCGATAGAACCTCTCGAG,IntFwd:GGCCCACTATGAACCAGCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr. Biol. 2013 23(11) 1007-12 
[ PubMed ID = 23664973 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet. 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]

Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(1) 254-9 
[ PubMed ID = 21173231 ] [ RRC reference ]