Mutants (Isolated)

tm897

Allele Nametm897
Sequence NameZK970.6
CGC Namegcy-5
Worm BaseAllele Name tm897
CGC Name gcy-5
Sequence ZK970.6
Phenotypehomozygous viable. Dr. O. Hobert: Genetics 173, 131-149 (2006). Dr. Y. Iino: fertile, normal locomotion, normal chemotaxis to KCl.
Mutation site28479/28480-GGGGTAGAAGAGGC-29170/29171 (691 bp deletion + 14 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(24276..24676, 24727..24830, 24882..25289, 25685..25859, 26819..27119, 27176..27829, 27892..28016, 28151..28289, 28462..28587, 28632..28726, 28791..29173, 29528..29770, 29816..29946, 30012..30095))
Map position2.24
Balancer
Map position of balancer
Sequence of primersIntFwd:GGACGCCGTATTGATCCCAA,ExtRev:CAGCCGCACAAGACACTCAA,ExtFwd:GATGGCCCGGATTGTAGTGA,IntRev:CGATAGAGCAAGCGTCGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ortiz CO, Etchberger JF, Posy SL, FrĂžkjaer-Jensen C, Lockery S, Honig B, Hobert O.
Searching for neuronal left/right asymmetry: genomewide analysis of nematode receptor-type guanylyl cyclases.
Genetics 2006 173(1) 131-49 
[ PubMed ID = 16547101 ] [ RRC reference ]

Horspool AM, Chang HC.
Neuron-specific regulation of superoxide dismutase amid pathogen-induced gut dysbiosis.
Redox Biol 2018 17 377-385 
[ PubMed ID = 29857312 ] [ RRC reference ]

Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr. Biol. 2013 23(11) 1007-12 
[ PubMed ID = 23664973 ] [ RRC reference ]