分離済み変異体

tm894

Allele Name

tm894

Allele Type

通常株

Sequence Name

F56A6.1

Gene Name

sago-2

Worm Base

Allele Name

tm894

Gene Name

sago-2

Sequence

F56A6.1

Phenotype

homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).

Mutation site

40599/40600-GGGGGG-40867/40868 (268 bp deletion + 6 bp insertion)

Chromosome

Putative gene structure

join(39766..39916, 39974..40227, 40272..40471, 40518..40577, 40628..40746, 40806..41248, 41297..41583, 41629..42025, 42072..42727, 42774..42870)

Map position

-18.77

Balancer

Map position of balancer

Sequence of primers

IntRev:CGGCAAACGCAATCTTAGGT,ExtRev:GTCGGTTACCGGCAAACGCA,ExtFwd:GCTATTACATGAGTCACACC,IntFwd:AAGCTATGTCCGTCTCGGAC

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Wang SY, Kim K, O'Brown ZK, Levan A, Dodson AE, Kennedy SG, Chernoff C, Greer EL.
Hypoxia induces transgenerational epigenetic inheritance of small RNAs.
Cell Rep 2022 41(11) 111800
[ PubMed ID = 36516753 ] [ RRC reference ]

Watts JS, Harrison HF, Omi S, Guenthers Q, Dalelio J, Pujol N, Watts JL.
New Strains for Tissue-Specific RNAi Studies in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 4167-4176
[ PubMed ID = 32943454 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)
[ PubMed ID = 29018118 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc Natl Acad Sci U S A 2010 107(8) 3582-7
[ PubMed ID = 20133583 ] [ RRC reference ]

Wu X, Shi Z, Cui M, Han M, Ruvkun G.
Repression of germline RNAi pathways in somatic cells by retinoblastoma pathway chromatin complexes.
PLoS Genet 2012 8(3) e1002542
[ PubMed ID = 22412383 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19
[ PubMed ID = 23329696 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat Genet 2012 44(2) 157-64
[ PubMed ID = 22231482 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32
[ PubMed ID = 24532782 ] [ RRC reference ]

Buckley BA, Burkhart KB, Gu SG, Spracklin G, Kershner A, Fritz H, Kimble J, Fire A, Kennedy S.
A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.
Nature 2012 489(7416) 447-51
[ PubMed ID = 22810588 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624
[ PubMed ID = 19714217 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57
[ PubMed ID = 17110334 ] [ RRC reference ]