分離済み変異体

tm894

Allele Nametm894
BalanceNot Required
OutCrossNot Accepted
Sequence NameF56A6.1
Gene Namesago-2
Worm BaseAllele Name tm894
Gene Name sago-2
Sequence F56A6.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 40599/40600-GGGGGG-40867/40868 (268 bp deletion + 6 bp insertion)
ChromosomeI
Putative gene structurejoin(39766..39916, 39974..40227, 40272..40471, 40518..40577, 40628..40746, 40806..41248, 41297..41583, 41629..42025, 42072..42727, 42774..42870)
Map position-18.77
Balancer
Map position of balancer
Sequence of primersIntRev:CGGCAAACGCAATCTTAGGT,ExtRev:GTCGGTTACCGGCAAACGCA,ExtFwd:GCTATTACATGAGTCACACC,IntFwd:AAGCTATGTCCGTCTCGGAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Castiglioni VG, Olmo-Uceda MJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF.
Story of an infection: Viral dynamics and host responses in the Caenorhabditis elegans-Orsay virus pathosystem.
Sci Adv 2024 10(39) eadn5945 
[ PubMed ID = 39331715 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Dube F, Hinas A, Delhomme N, Åbrink M, Svärd S, Tydén E.
Transcriptomics of ivermectin response in Caenorhabditis elegans: Integrating abamectin quantitative trait loci and comparison to the Ivermectin-exposed DA1316 strain.
PLoS One 2023 18(5) e0285262 
[ PubMed ID = 37141255 ] [ RRC reference ]

Wang SY, Kim K, O'Brown ZK, Levan A, Dodson AE, Kennedy SG, Chernoff C, Greer EL.
Hypoxia induces transgenerational epigenetic inheritance of small RNAs.
Cell Rep 2022 41(11) 111800 
[ PubMed ID = 36516753 ] [ RRC reference ]

Watts JS, Harrison HF, Omi S, Guenthers Q, Dalelio J, Pujol N, Watts JL.
New Strains for Tissue-Specific RNAi Studies in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 4167-4176 
[ PubMed ID = 32943454 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Buckley BA, Burkhart KB, Gu SG, Spracklin G, Kershner A, Fritz H, Kimble J, Fire A, Kennedy S.
A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.
Nature 2012 489(7416) 447-51 
[ PubMed ID = 22810588 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat Genet 2012 44(2) 157-64 
[ PubMed ID = 22231482 ] [ RRC reference ]

Wu X, Shi Z, Cui M, Han M, Ruvkun G.
Repression of germline RNAi pathways in somatic cells by retinoblastoma pathway chromatin complexes.
PLoS Genet 2012 8(3) e1002542 
[ PubMed ID = 22412383 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc Natl Acad Sci U S A 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]