Mutants (Isolated)

tm894

Allele Nametm894
Sequence NameF56A6.1
CGC Namesago-2
Worm BaseAllele Name tm894
CGC Name sago-2
Sequence F56A6.1
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site40599/40600-GGGGGG-40867/40868 (268 bp deletion + 6 bp insertion)
ChromosomeI
Putative gene structurejoin(39766..39916, 39974..40227, 40272..40471, 40518..40577, 40628..40746, 40806..41248, 41297..41583, 41629..42025, 42072..42727, 42774..42870)
Map position-18.77
Balancer
Map position of balancer
Sequence of primersIntRev:CGGCAAACGCAATCTTAGGT,ExtRev:GTCGGTTACCGGCAAACGCA,ExtFwd:GCTATTACATGAGTCACACC,IntFwd:AAGCTATGTCCGTCTCGGAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Buckley BA, Burkhart KB, Gu SG, Spracklin G, Kershner A, Fritz H, Kimble J, Fire A, Kennedy S.
A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.
Nature 2012 489(7416) 447-51 
[ PubMed ID = 22810588 ] [ RRC reference ]

Wu X, Shi Z, Cui M, Han M, Ruvkun G.
Repression of germline RNAi pathways in somatic cells by retinoblastoma pathway chromatin complexes.
PLoS Genet. 2012 8(3) e1002542 
[ PubMed ID = 22412383 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat. Genet. 2012 44(2) 157-64 
[ PubMed ID = 22231482 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]