Mutants (Isolated)

tm887

Allele Nametm887
Sequence NameC06A1.4
CGC NameC06A1.4
Worm BaseAllele Name tm887
CGC Name C06A1.4
Sequence C06A1.4
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site17503/17504-18100/18101 (597 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(15637..15754, 15801..16165, 16213..16458, 16507..16681, 16730..16898, 16945..17120, 17165..17891, 17936..18341, 18386..18476, 18597..18787, 18833..18988))
Map position3.09
Balancer
Map position of balancer
Sequence of primersExtFwd:GACCGCCATTATGGAACCTT,IntFwd:TTCGCTGAGCGAGTGCATCA,ExtRev:GCCCTTCCATCAGTCTACAC,IntRev:CCGCTAAGATCGGAGTATCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat. Genet. 2012 44(2) 157-64 
[ PubMed ID = 22231482 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]