Mutants (Isolated)

tm876

Allele Nametm876
Sequence NameC17A2.1
CGC Namenhr-257
Worm BaseAllele Name tm876
CGC Name nhr-257
Sequence C17A2.1
Phenotypehomozygous viable
Mutation site22857/22858-23348/23349 (491 bp deletion)
ChromosomeII
Putative gene structurejoin(22957..22972, 23125..23268, 23317..23382, 23431..23499, 23549..23691, 23869..24095, 24141..24342, 24409..24483, 24529..24582)
Map position-6.2
Balancer
Map position of balancer
Sequence of primersIntFwd:CGGCCGCAAGAACTTTATGA,IntRev:TGGTCTGCGACGTTTTGTGA,ExtRev:TGGCCTTGTGCAACAATTCT,ExtFwd:AGTTCCCTTAGACGGCCGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Heestand B, Simon M, Frenk S, Titov D, Ahmed S.
Transgenerational Sterility of Piwi Mutants Represents a Dynamic Form of Adult Reproductive Diapause.
Cell Rep 2018 23(1) 156-171 
[ PubMed ID = 29617657 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420 
[ PubMed ID = 33658512 ] [ RRC reference ]