Mutants (Isolated)

tm872

Allele Nametm872
Sequence NameD2030.6
CGC Nameprg-1
Worm BaseAllele Name tm872
CGC Name prg-1
Sequence D2030.6
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. E. Miska; Mol Cell 31, 79-90 (2008).
Mutation site21432/21433-22072/22073 (640 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(20481..20636, 20682..20868, 20915..21152, 21201..21375, 21423..21787, 21834..22275, 22320..22562, 22611..22925, 22975..23328))
Map position2.18
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:CTGTAGAGGATCAAGCGGCT,IntFwd:AGTCGTGGTACAGATCGTAG,ExtRev:GGGATATCTCGCAACGACTA,IntRev:GAGAGGCCGTGGTTCAGGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gent JI, Schvarzstein M, Villeneuve AM, Gu SG, Jantsch V, Fire AZ, Baudrimont A.
A Caenorhabditis elegans RNA-directed RNA polymerase in sperm development and endogenous RNA interference.
Genetics 2009 183(4) 1297-314 
[ PubMed ID = 19805814 ] [ RRC reference ]

Lee HC, Gu W, Shirayama M, Youngman E, Conte D Jr, Mello CC.
C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.
Cell 2012 150(1) 78-87 
[ PubMed ID = 22738724 ] [ RRC reference ]

Tang W, Seth M, Tu S, Shen EZ, Li Q, Shirayama M, Weng Z, Mello CC.
A Sex Chromosome piRNA Promotes Robust Dosage Compensation and Sex Determination in C. elegans.
Dev. Cell 2018 44(6) 762-770.e3 
[ PubMed ID = 29456136 ] [ RRC reference ]

Shen EZ, Chen H, Ozturk AR, Tu S, Shirayama M, Tang W, Ding YH, Dai SY, Weng Z, Mello CC.
Identification of piRNA Binding Sites Reveals the Argonaute Regulatory Landscape of the C. elegans Germline.
Cell 2018 172(5) 937-951.e18 
[ PubMed ID = 29456082 ] [ RRC reference ]

Seth M, Shirayama M, Tang W, Shen EZ, Tu S, Lee HC, Weng Z, Mello CC.
The Coding Regions of Germline mRNAs Confer Sensitivity to Argonaute Regulation in C. elegans.
Cell Rep 2018 22(9) 2254-2264 
[ PubMed ID = 29456100 ] [ RRC reference ]

Cecere G, Zheng GX, Mansisidor AR, Klymko KE, Grishok A.
Promoters recognized by forkhead proteins exist for individual 21U-RNAs.
Mol. Cell 2012 47(5) 734-45 
[ PubMed ID = 22819322 ] [ RRC reference ]

Simon M, Sarkies P, Ikegami K, Doebley AL, Goldstein LD, Mitchell J, Sakaguchi A, Miska EA, Ahmed S.
Reduced insulin/IGF-1 signaling restores germ cell immortality to Caenorhabditis elegans Piwi mutants.
Cell Rep 2014 7(3) 762-73 
[ PubMed ID = 24767993 ] [ RRC reference ]

Das PP, Bagijn MP, Goldstein LD, Woolford JR, Lehrbach NJ, Sapetschnig A, Buhecha HR, Gilchrist MJ, Howe KL, Stark R, Matthews N, Berezikov E, Ketting RF, Tavaré S, Miska EA.
Piwi and piRNAs act upstream of an endogenous siRNA pathway to suppress Tc3 transposon mobility in the Caenorhabditis elegans germline.
Mol. Cell 2008 31(1) 79-90 
[ PubMed ID = 18571451 ] [ RRC reference ]

Billi AC, Freeberg MA, Day AM, Chun SY, Khivansara V, Kim JK.
A conserved upstream motif orchestrates autonomous, germline-enriched expression of Caenorhabditis elegans piRNAs.
PLoS Genet. 2013 9(3) e1003392 
[ PubMed ID = 23516384 ] [ RRC reference ]

Barberán-Soler S, Fontrodona L, Ribó A, Lamm AT, Iannone C, Cerón J, Lehner B, Valcárcel J.
Co-option of the piRNA pathway for germline-specific alternative splicing of C. elegans TOR.
Cell Rep 2014 8(6) 1609-1616 
[ PubMed ID = 25220461 ] [ RRC reference ]

Seth M, Shirayama M, Gu W, Ishidate T, Conte D Jr, Mello CC.
The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.
Dev. Cell 2013 27(6) 656-63 
[ PubMed ID = 24360782 ] [ RRC reference ]

Batista PJ, Ruby JG, Claycomb JM, Chiang R, Fahlgren N, Kasschau KD, Chaves DA, Gu W, Vasale JJ, Duan S, Conte D Jr, Luo S, Schroth GP, Carrington JC, Bartel DP, Mello CC.
PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans.
Mol. Cell 2008 31(1) 67-78 
[ PubMed ID = 18571452 ] [ RRC reference ]

Wang G, Reinke V.
A C. elegans Piwi, PRG-1, regulates 21U-RNAs during spermatogenesis.
Curr. Biol. 2008 18(12) 861-7 
[ PubMed ID = 18501605 ] [ RRC reference ]

Billi AC, Alessi AF, Khivansara V, Han T, Freeberg M, Mitani S, Kim JK.
The Caenorhabditis elegans HEN1 ortholog, HENN-1, methylates and stabilizes select subclasses of germline small RNAs.
PLoS Genet. 2012 8(4) e1002617 
[ PubMed ID = 22548001 ] [ RRC reference ]

Leopold LE, Heestand BN, Seong S, Shtessel L, Ahmed S.
Lack of pairing during meiosis triggers multigenerational transgene silencing in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(20) E2667-76 
[ PubMed ID = 25941370 ] [ RRC reference ]

Shirayama M, Seth M, Lee HC, Gu W, Ishidate T, Conte D Jr, Mello CC.
piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.
Cell 2012 150(1) 65-77 
[ PubMed ID = 22738726 ] [ RRC reference ]

Goh WS, Seah JW, Harrison EJ, Chen C, Hammell CM, Hannon GJ.
A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis.
Genes Dev. 2014 28(7) 797-807 
[ PubMed ID = 24696458 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]