Mutants (Isolated)

tm869

Allele Nametm869
Sequence NameK10C8.1
CGC Nameparn-1
Worm BaseAllele Name tm869
CGC Name parn-1
Sequence K10C8.1
Phenotypehomozygous viable
Mutation site12855/12856-TT-13742/13743 (887 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(11155..11326, 11377..11454, 11502..11804, 12433..13197, 13247..13444, 13639..13868))
Map position4.61
Balancer
Map position of balancer
Sequence of primersIntFwd:CCCGACCATATCCACCTTAT,ExtFwd:CTGGCCGATTCCCTACTATC,ExtRev:CGGTCTACACGTATCCGTTT,IntRev:TGAGCGGTCGAATTGGACGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kow RL, Strovas TJ, McMillan PJ, Jacobi AM, Behlke MA, Saxton AD, Latimer CS, Keene CD, Kraemer BC.
Distinct Poly(A) nucleases have differential impact on sut-2 dependent tauopathy phenotypes.
Neurobiol Dis 2021 147 105148 
[ PubMed ID = 33184027 ] [ RRC reference ]

Zeng C, Weng C, Wang X, Yan YH, Li WJ, Xu D, Hong M, Liao S, Dong MQ, Feng X, Xu C, Guang S.
Functional Proteomics Identifies a PICS Complex Required for piRNA Maturation and Chromosome Segregation.
Cell Rep 2019 27(12) 3561-3572.e3 
[ PubMed ID = 31216475 ] [ RRC reference ]

Nousch M, Yeroslaviz A, Eckmann CR.
Stage-specific combinations of opposing poly(A) modifying enzymes guide gene expression during early oogenesis.
Nucleic Acids Res 2019 47(20) 10881-10893 
[ PubMed ID = 31511882 ] [ RRC reference ]

Tang W, Tu S, Lee HC, Weng Z, Mello CC.
The RNase PARN-1 Trims piRNA 3' Ends to Promote Transcriptome Surveillance in C. elegans.
Cell 2016 164(5) 974-84 
[ PubMed ID = 26919432 ] [ RRC reference ]

Nousch M, Techritz N, Hampel D, Millonigg S, Eckmann CR.
The Ccr4-Not deadenylase complex constitutes the main poly(A) removal activity in C. elegans.
J Cell Sci 2013 126(Pt 18) 4274-85 
[ PubMed ID = 23843623 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Masse I, Molin L, Mouchiroud L, Vanhems P, Palladino F, Billaud M, Solari F.
A novel role for the SMG-1 kinase in lifespan and oxidative stress resistance in Caenorhabditis elegans.
PLoS One 2008 3(10) e3354 
[ PubMed ID = 18836529 ] [ RRC reference ]