分離済み変異体

tm869

Allele Name

tm869

Allele Type

通常株

Sequence Name

K10C8.1

Gene Name

parn-1

Worm Base

Allele Name

tm869

Gene Name

parn-1

Sequence

K10C8.1

Phenotype

homozygous viable

Mutation site

12855/12856-TT-13742/13743 (887 bp deletion + 2 bp insertion)

Chromosome

Putative gene structure

complement(join(11155..11326, 11377..11454, 11502..11804, 12433..13197, 13247..13444, 13639..13868))

Map position

4.61

Balancer

Map position of balancer

Sequence of primers

IntFwd:CCCGACCATATCCACCTTAT,ExtFwd:CTGGCCGATTCCCTACTATC,ExtRev:CGGTCTACACGTATCCGTTT,IntRev:TGAGCGGTCGAATTGGACGA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Pastore B, Hertz HL, Tang W.
Pre-piRNA trimming safeguards piRNAs against erroneous targeting by RNA-dependent RNA polymerase.
Cell Rep 2024 43(2) 113692
[ PubMed ID = 38244197 ] [ RRC reference ]

Pastore B, Hertz HL, Price IF, Tang W.
pre-piRNA trimming and 2'-O-methylation protect piRNAs from 3' tailing and degradation in C. elegans.
Cell Rep 2021 36(9) 109640
[ PubMed ID = 34469728 ] [ RRC reference ]

Kow RL, Strovas TJ, McMillan PJ, Jacobi AM, Behlke MA, Saxton AD, Latimer CS, Keene CD, Kraemer BC.
Distinct Poly(A) nucleases have differential impact on sut-2 dependent tauopathy phenotypes.
Neurobiol Dis 2021 147 105148
[ PubMed ID = 33184027 ] [ RRC reference ]

Zeng C, Weng C, Wang X, Yan YH, Li WJ, Xu D, Hong M, Liao S, Dong MQ, Feng X, Xu C, Guang S.
Functional Proteomics Identifies a PICS Complex Required for piRNA Maturation and Chromosome Segregation.
Cell Rep 2019 27(12) 3561-3572.e3
[ PubMed ID = 31216475 ] [ RRC reference ]

Nousch M, Yeroslaviz A, Eckmann CR.
Stage-specific combinations of opposing poly(A) modifying enzymes guide gene expression during early oogenesis.
Nucleic Acids Res 2019 47(20) 10881-10893
[ PubMed ID = 31511882 ] [ RRC reference ]

Tang W, Tu S, Lee HC, Weng Z, Mello CC.
The RNase PARN-1 Trims piRNA 3' Ends to Promote Transcriptome Surveillance in C. elegans.
Cell 2016 164(5) 974-84
[ PubMed ID = 26919432 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6
[ PubMed ID = 29395906 ] [ RRC reference ]

Nousch M, Techritz N, Hampel D, Millonigg S, Eckmann CR.
The Ccr4-Not deadenylase complex constitutes the main poly(A) removal activity in C. elegans.
J Cell Sci 2013 126(Pt 18) 4274-85
[ PubMed ID = 23843623 ] [ RRC reference ]

Masse I, Molin L, Mouchiroud L, Vanhems P, Palladino F, Billaud M, Solari F.
A novel role for the SMG-1 kinase in lifespan and oxidative stress resistance in Caenorhabditis elegans.
PLoS One 2008 3(10) e3354
[ PubMed ID = 18836529 ] [ RRC reference ]