Mutants (Isolated)

tm869

Allele Nametm869
Sequence NameK10C8.1
CGC Nameparn-1
Worm BaseAllele Name tm869
CGC Name parn-1
Sequence K10C8.1
Phenotypehomozygous viable
Mutation site12855/12856-TT-13742/13743 (887 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(11155..11326, 11377..11454, 11502..11804, 12433..13197, 13247..13444, 13639..13868))
Map position4.61
Balancer
Map position of balancer
Sequence of primersIntFwd:CCCGACCATATCCACCTTAT,ExtFwd:CTGGCCGATTCCCTACTATC,ExtRev:CGGTCTACACGTATCCGTTT,IntRev:TGAGCGGTCGAATTGGACGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Masse I, Molin L, Mouchiroud L, Vanhems P, Palladino F, Billaud M, Solari F.
A novel role for the SMG-1 kinase in lifespan and oxidative stress resistance in Caenorhabditis elegans.
PLoS ONE 2008 3(10) e3354 
[ PubMed ID = 18836529 ] [ RRC reference ]

Nousch M, Techritz N, Hampel D, Millonigg S, Eckmann CR.
The Ccr4-Not deadenylase complex constitutes the main poly(A) removal activity in C. elegans.
J. Cell. Sci. 2013 126(Pt 18) 4274-85 
[ PubMed ID = 23843623 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]