分離済み変異体

tm866

Allele Nametm866
BalanceNot Required
OutCrossNot Accepted
Sequence NameC42D8.4
Gene Nameets-5
Worm BaseAllele Name tm866
Gene Name ets-5
Sequence C42D8.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Hobert: no effect on dat-1::gfp expression. Nature. 2009 458:885.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 429/430-1731/1732 (1302 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(830..895, 943..1052, 1105..1243, 2314..2386, 2436..2674))
Map position-6.2
Balancer
Map position of balancer
Sequence of primersIntRev:GCGAGTGTATTTAGACTCAG,ExtRev:GGGGTAAGCCTATCATAGTT,ExtFwd:CGCTGCAAATCGGACTAAAA,IntFwd:CATGCAGCCTAGTATTTTCC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Taylor M, Marx O, Norris A.
TDP-1 and FUST-1 co-inhibit exon inclusion and control fertility together with transcriptional regulation.
Nucleic Acids Res 2023 51(18) 9610-9628 
[ PubMed ID = 37587694 ] [ RRC reference ]

Godini R, Pocock R.
Characterization of the Doublesex/MAB-3 transcription factor DMD-9 in Caenorhabditis elegans.
G3 (Bethesda) 2023 13(2)  
[ PubMed ID = 36454093 ] [ RRC reference ]

McCulloch KA, Zhou K, Jin Y.
Neuronal transcriptome analyses reveal novel neuropeptide modulators of excitation and inhibition imbalance in C. elegans.
PLoS One 2020 15(6) e0233991 
[ PubMed ID = 32497060 ] [ RRC reference ]

Juozaityte V, Pladevall-Morera D, Podolska A, Nørgaard S, Neumann B, Pocock R.
The ETS-5 transcription factor regulates activity states in Caenorhabditis elegans by controlling satiety.
Proc Natl Acad Sci U S A 2017 114(9) E1651-E1658 
[ PubMed ID = 28193866 ] [ RRC reference ]

Guillermin ML, Castelletto ML, Hallem EA.
Differentiation of carbon dioxide-sensing neurons in Caenorhabditis elegans requires the ETS-5 transcription factor.
Genetics 2011 189(4) 1327-39 
[ PubMed ID = 21954162 ] [ RRC reference ]

Flames N, Hobert O.
Gene regulatory logic of dopamine neuron differentiation.
Nature 2009 458(7240) 885-9 
[ PubMed ID = 19287374 ] [ RRC reference ]