Mutants (Isolated)

tm858

Allele Nametm858
Sequence NameC06G4.2
CGC Nameclp-1
Worm BaseAllele Name tm858
CGC Name clp-1
Sequence C06G4.2
Phenotypehomozygous viable. Dr. M. Driscoll: normal brood size, development, locomotion. Dr. N. Tavernarakis: suppression of neurodegeneration, normal development, normal locomotion, normal body size/shape, normal brood size. Dr. M. Hengartner: clp-1(tm858); deg-3(u662) shows reduced vacuolization compared to deg-3(u662)
Mutation site6097/6098-TTTTTTTTTTT-6503/6504 (406 bp deletion + 11 bp insertion)
ChromosomeIII
Putative gene structurejoin(4799..4874, 5795..5923, 5971..6413, 6456..6614, 6685..6947, 7008..7139, 7514..7983, 8028..8104, 8729..8818, 8865..8987)
Map position-0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:CAATGATATCGGTGGACTCA,IntFwd:TCATCAACAGTATGGGAGGT,IntRev:GGCCTTGACACCAGTCATTT,ExtRev:CAAACCATTCCAGCGGCCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Samara C, Syntichaki P, Tavernarakis N.
Autophagy is required for necrotic cell death in Caenorhabditis elegans.
Cell Death Differ. 2008 15(1) 105-12 
[ PubMed ID = 17901876 ] [ RRC reference ]

Bano D, Dinsdale D, Cabrera-Socorro A, Maida S, Lambacher N, McColl B, Ferrando-May E, Hengartner MO, Nicotera P.
Alteration of the nuclear pore complex in Ca(2+)-mediated cell death.
Cell Death Differ. 2010 17(1) 119-33 
[ PubMed ID = 19713973 ] [ RRC reference ]

Mano I, Driscoll M.
Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity.
J. Neurochem. 2009 108(6) 1373-84 
[ PubMed ID = 19054279 ] [ RRC reference ]