| Allele Name | tm858 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C06G4.2 |
| Gene Name | clp-1 |
| Worm Base | Allele Name |
tm858
|
| Gene Name |
clp-1
|
| Sequence |
C06G4.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. M. Driscoll: normal brood size, development, locomotion. Dr. N. Tavernarakis: suppression of neurodegeneration, normal development, normal locomotion, normal body size/shape, normal brood size. Dr. M. Hengartner: clp-1(tm858); deg-3(u662) shows reduced vacuolization compared to deg-3(u662) |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 6097/6098-TTTTTTTTTTT-6503/6504 (406 bp deletion + 11 bp insertion) |
| Chromosome | III |
| Putative gene structure | join(4799..4874, 5795..5923, 5971..6413, 6456..6614, 6685..6947, 7008..7139, 7514..7983, 8028..8104, 8729..8818, 8865..8987) |
| Map position | -0.45 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CAATGATATCGGTGGACTCA,IntFwd:TCATCAACAGTATGGGAGGT,IntRev:GGCCTTGACACCAGTCATTT,ExtRev:CAAACCATTCCAGCGGCCTT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Donato A, Ritchie FK, Lu L, Wadia M, Martinez-Marmol R, Kaulich E, Sankorrakul K, Lu H, Coakley S, Coulson EJ, Hilliard MA. OSP-1 protects neurons from autophagic cell death induced by acute oxidative stress. Nat Commun 2025 16(1) 300
[ PubMed ID = 39746999 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Bano D, Dinsdale D, Cabrera-Socorro A, Maida S, Lambacher N, McColl B, Ferrando-May E, Hengartner MO, Nicotera P. Alteration of the nuclear pore complex in Ca(2+)-mediated cell death. Cell Death Differ 2010 17(1) 119-33
[ PubMed ID = 19713973 ]
[ RRC reference ]
|
Mano I, Driscoll M. Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity. J Neurochem 2009 108(6) 1373-84
[ PubMed ID = 19054279 ]
[ RRC reference ]
|
Samara C, Syntichaki P, Tavernarakis N. Autophagy is required for necrotic cell death in Caenorhabditis elegans. Cell Death Differ 2008 15(1) 105-12
[ PubMed ID = 17901876 ]
[ RRC reference ]
|
|