Mutants (Isolated)

tm853

Allele Nametm853
Sequence NameT06E4.3
CGC Nameatl-1
Worm BaseAllele Name tm853
CGC Name atl-1
Sequence T06E4.3
Phenotypelethal or sterile. Dr. H. Sawa: maternal effect lethal. Dr. M. Hengartner: induction of germ cell death upon genotyoxic stress. Dr. S. Boulton: EMBO J. 24, 4345-4355 (2005). Dr. S. Boulton: EMBO J, 25, 2178-2188 (2006). Dr. A. Higashitani: Genetics 180, 681 (2008).
Mutation site27446/27447-AGCGGGATATACAG-28166/28167 (720 bp deletion + 14 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(19461..19658, 19707..20387, 20436..20561, 20820..21473, 21653..22681, 22730..22861, 22909..23442, 25230..25533, 25582..25874, 25919..26129, 26179..27501, 27546..28624, 28672..28899, 28945..29427, 29476..29555, 29600..29664, 29713..29814, 29862..29935))
Map position2.06
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:GAGTCAACTGTCTTGGCTCA,IntFwd:GAAACGTGTATCCCATCGAA,ExtRev:TTCGTCCCGTCTATAGACAA,IntRev:CGAGTCATCGAGAGCTACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Garcia-Muse T, Boulton SJ.
Distinct modes of ATR activation after replication stress and DNA double-strand breaks in Caenorhabditis elegans.
EMBO J. 2005 24(24) 4345-55 
[ PubMed ID = 16319925 ] [ RRC reference ]

Stergiou L, Doukoumetzidis K, Sendoel A, Hengartner MO.
The nucleotide excision repair pathway is required for UV-C-induced apoptosis in Caenorhabditis elegans.
Cell Death Differ. 2007 14(6) 1129-38 
[ PubMed ID = 17347667 ] [ RRC reference ]

Zermati Y, Mouhamad S, Stergiou L, Besse B, Galluzzi L, Boehrer S, Pauleau AL, Rosselli F, D'Amelio M, Amendola R, Castedo M, Hengartner M, Soria JC, Cecconi F, Kroemer G.
Nonapoptotic role for Apaf-1 in the DNA damage checkpoint.
Mol. Cell 2007 28(4) 624-37 
[ PubMed ID = 18042457 ] [ RRC reference ]

Budirahardja Y, Gönczy P.
PLK-1 asymmetry contributes to asynchronous cell division of C. elegans embryos.
Development 2008 135(7) 1303-13 
[ PubMed ID = 18305005 ] [ RRC reference ]

Greiss S, Hall J, Ahmed S, Gartner A.
C. elegans SIR-2.1 translocation is linked to a proapoptotic pathway parallel to cep-1/p53 during DNA damage-induced apoptosis.
Genes Dev. 2008 22(20) 2831-42 
[ PubMed ID = 18923081 ] [ RRC reference ]

Mori C, Takanami T, Higashitani A.
Maintenance of mitochondrial DNA by the Caenorhabditis elegans ATR checkpoint protein ATL-1.
Genetics 2008 180(1) 681-6 
[ PubMed ID = 18716329 ] [ RRC reference ]

Aristizábal-Corrales D, Fontrodona L, Porta-de-la-Riva M, Guerra-Moreno A, Cerón J, Schwartz S Jr.
The 14-3-3 gene par-5 is required for germline development and DNA damage response in Caenorhabditis elegans.
J. Cell. Sci. 2012 125(Pt 7) 1716-26 
[ PubMed ID = 22328524 ] [ RRC reference ]

Rutkowski R, Dickinson R, Stewart G, Craig A, Schimpl M, Keyse SM, Gartner A.
Regulation of Caenorhabditis elegans p53/CEP-1-dependent germ cell apoptosis by Ras/MAPK signaling.
PLoS Genet. 2011 7(8) e1002238 
[ PubMed ID = 21901106 ] [ RRC reference ]

Woglar A, Daryabeigi A, Adamo A, Habacher C, Machacek T, La Volpe A, Jantsch V.
Matefin/SUN-1 phosphorylation is part of a surveillance mechanism to coordinate chromosome synapsis and recombination with meiotic progression and chromosome movement.
PLoS Genet. 2013 9(3) e1003335 
[ PubMed ID = 23505384 ] [ RRC reference ]

Spiga FM, Prouteau M, Gotta M.
The TAO kinase KIN-18 regulates contractility and establishment of polarity in the C. elegans embryo.
Dev. Biol. 2013 373(1) 26-38 
[ PubMed ID = 23064028 ] [ RRC reference ]

Penkner AM, Fridkin A, Gloggnitzer J, Baudrimont A, Machacek T, Woglar A, Csaszar E, Pasierbek P, Ammerer G, Gruenbaum Y, Jantsch V.
Meiotic chromosome homology search involves modifications of the nuclear envelope protein Matefin/SUN-1.
Cell 2009 139(5) 920-33 
[ PubMed ID = 19913286 ] [ RRC reference ]

Collis SJ, Barber LJ, Ward JD, Martin JS, Boulton SJ.
C. elegans FANCD2 responds to replication stress and functions in interstrand cross-link repair.
DNA Repair (Amst.) 2006 5(11) 1398-406 
[ PubMed ID = 16914393 ] [ RRC reference ]

Polanowska J, Martin JS, Garcia-Muse T, Petalcorin MI, Boulton SJ.
A conserved pathway to activate BRCA1-dependent ubiquitylation at DNA damage sites.
EMBO J. 2006 25(10) 2178-88 
[ PubMed ID = 16628214 ] [ RRC reference ]

Ermolaeva MA, Segref A, Dakhovnik A, Ou HL, Schneider JI, Utermöhlen O, Hoppe T, Schumacher B.
DNA damage in germ cells induces an innate immune response that triggers systemic stress resistance.
Nature 2013 501(7467) 416-20 
[ PubMed ID = 23975097 ] [ RRC reference ]

DeBardeleben HK, Lopes LE, Nessel MP, Raizen DM.
Stress-Induced Sleep After Exposure to Ultraviolet Light Is Promoted by p53 in Caenorhabditis elegans.
Genetics 2017 207(2) 571-582 
[ PubMed ID = 28754659 ] [ RRC reference ]

Lawrence KS, Chau T, Engebrecht J.
DNA damage response and spindle assembly checkpoint function throughout the cell cycle to ensure genomic integrity.
PLoS Genet. 2015 11(4) e1005150 
[ PubMed ID = 25898113 ] [ RRC reference ]

Moriwaki T, Kato Y, Nakamura C, Ishikawa S, Zhang-Akiyama QM.
A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells.
Genes Cancer 2015 6(7-8) 341-55 
[ PubMed ID = 26413217 ] [ RRC reference ]

Merlet J, Burger J, Tavernier N, Richaudeau B, Gomes JE, Pintard L.
The CRL2LRR-1 ubiquitin ligase regulates cell cycle progression during C. elegans development.
Development 2010 137(22) 3857-66 
[ PubMed ID = 20978077 ] [ RRC reference ]

Lee SJ, Gartner A, Hyun M, Ahn B, Koo HS.
The Caenorhabditis elegans Werner syndrome protein functions upstream of ATR and ATM in response to DNA replication inhibition and double-strand DNA breaks.
PLoS Genet. 2010 6(1) e1000801 
[ PubMed ID = 20062519 ] [ RRC reference ]

Youds JL, Barber LJ, Ward JD, Collis SJ, O'Neil NJ, Boulton SJ, Rose AM.
DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair.
Mol. Cell. Biol. 2008 28(5) 1470-9 
[ PubMed ID = 18086896 ] [ RRC reference ]