分離済み変異体

tm853

Allele Nametm853
Allele Typeバランス済
Sequence NameT06E4.3
Gene Nameatl-1
Worm BaseAllele Name tm853
Gene Name atl-1
Sequence T06E4.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. H. Sawa: maternal effect lethal. Dr. M. Hengartner: induction of germ cell death upon genotyoxic stress. Dr. S. Boulton: EMBO J. 24, 4345-4355 (2005). Dr. S. Boulton: EMBO J, 25, 2178-2188 (2006). Dr. A. Higashitani: Genetics 180, 681 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27446/27447-AGCGGGATATACAG-28166/28167 (720 bp deletion + 14 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(19461..19658, 19707..20387, 20436..20561, 20820..21473, 21653..22681, 22730..22861, 22909..23442, 25230..25533, 25582..25874, 25919..26129, 26179..27501, 27546..28624, 28672..28899, 28945..29427, 29476..29555, 29600..29664, 29713..29814, 29862..29935))
Map position2.06
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:GAGTCAACTGTCTTGGCTCA,IntFwd:GAAACGTGTATCCCATCGAA,ExtRev:TTCGTCCCGTCTATAGACAA,IntRev:CGAGTCATCGAGAGCTACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yu Z, Kim HJ, Dernburg AF.
ATM signaling modulates cohesin behavior in meiotic prophase and proliferating cells.
Nat Struct Mol Biol 2023 30(4) 436-450 
[ PubMed ID = 36879153 ] [ RRC reference ]

Guo H, Stamper EL, Sato-Carlton A, Shimazoe MA, Li X, Zhang L, Stevens L, Tam KCJ, Dernburg AF, Carlton PM.
Phosphoregulation of DSB-1 mediates control of meiotic double-strand break activity.
Elife 2022 11  
[ PubMed ID = 35758641 ] [ RRC reference ]

Das D, Trivedi S, Blazícková J, Arur S, Silva N.
Phosphorylation of HORMA-domain protein HTP-3 at Serine 285 is dispensable for crossover formation.
G3 (Bethesda) 2022 12(5)  
[ PubMed ID = 35389463 ] [ RRC reference ]

Borror MB, Girotti M, Kar A, Cain MK, Gao X, MacKay VL, Herron B, Bhaskaran S, Becerra S, Novy N, Ventura N, Johnson TE, Kennedy BK, Rea SL.
Inhibition of ATR Reverses a Mitochondrial Respiratory Insufficiency.
Cells 2022 11(11)  
[ PubMed ID = 35681427 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Li X, Boog H, Lehmer MK, Rosenberg SC, Barroso C, Martinez-Perez E, Corbett KD, Carlton PM.
Phosphoregulation of HORMA domain protein HIM-3 promotes asymmetric synaptonemal complex disassembly in meiotic prophase in Caenorhabditis elegans.
PLoS Genet 2020 16(11) e1008968 
[ PubMed ID = 33175901 ] [ RRC reference ]

Torgovnick A, Schiavi A, Shaik A, Kassahun H, Maglioni S, Rea SL, Johnson TE, Reinhardt HC, Honnen S, Schumacher B, Nilsen H, Ventura N.
BRCA1 and BARD1 mediate apoptotic resistance but not longevity upon mitochondrial stress in Caenorhabditis elegans.
EMBO Rep 2018 19(12)  
[ PubMed ID = 30366941 ] [ RRC reference ]

DeBardeleben HK, Lopes LE, Nessel MP, Raizen DM.
Stress-Induced Sleep After Exposure to Ultraviolet Light Is Promoted by p53 in Caenorhabditis elegans.
Genetics 2017 207(2) 571-582 
[ PubMed ID = 28754659 ] [ RRC reference ]

Lee SJ, Gartner A, Hyun M, Ahn B, Koo HS.
The Caenorhabditis elegans Werner syndrome protein functions upstream of ATR and ATM in response to DNA replication inhibition and double-strand DNA breaks.
PLoS Genet 2010 6(1) e1000801 
[ PubMed ID = 20062519 ] [ RRC reference ]

Merlet J, Burger J, Tavernier N, Richaudeau B, Gomes JE, Pintard L.
The CRL2LRR-1 ubiquitin ligase regulates cell cycle progression during C. elegans development.
Development 2010 137(22) 3857-66 
[ PubMed ID = 20978077 ] [ RRC reference ]

Black JC, Allen A, Van Rechem C, Forbes E, Longworth M, Tschöp K, Rinehart C, Quiton J, Walsh R, Smallwood A, Dyson NJ, Whetstine JR.
Conserved antagonism between JMJD2A/KDM4A and HP1γ during cell cycle progression.
Mol Cell 2010 40(5) 736-48 
[ PubMed ID = 21145482 ] [ RRC reference ]

Stergiou L, Eberhard R, Doukoumetzidis K, Hengartner MO.
NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans.
Cell Death Differ 2011 18(5) 897-906 
[ PubMed ID = 21151025 ] [ RRC reference ]

Vermezovic J, Stergiou L, Hengartner MO, d'Adda di Fagagna F.
Differential regulation of DNA damage response activation between somatic and germline cells in Caenorhabditis elegans.
Cell Death Differ 2012 19(11) 1847-55 
[ PubMed ID = 22705849 ] [ RRC reference ]

Spiga FM, Prouteau M, Gotta M.
The TAO kinase KIN-18 regulates contractility and establishment of polarity in the C. elegans embryo.
Dev Biol 2013 373(1) 26-38 
[ PubMed ID = 23064028 ] [ RRC reference ]

Woglar A, Daryabeigi A, Adamo A, Habacher C, Machacek T, La Volpe A, Jantsch V.
Matefin/SUN-1 phosphorylation is part of a surveillance mechanism to coordinate chromosome synapsis and recombination with meiotic progression and chromosome movement.
PLoS Genet 2013 9(3) e1003335 
[ PubMed ID = 23505384 ] [ RRC reference ]

Rutkowski R, Dickinson R, Stewart G, Craig A, Schimpl M, Keyse SM, Gartner A.
Regulation of Caenorhabditis elegans p53/CEP-1-dependent germ cell apoptosis by Ras/MAPK signaling.
PLoS Genet 2011 7(8) e1002238 
[ PubMed ID = 21901106 ] [ RRC reference ]

Aristizábal-Corrales D, Fontrodona L, Porta-de-la-Riva M, Guerra-Moreno A, Cerón J, Schwartz S Jr.
The 14-3-3 gene par-5 is required for germline development and DNA damage response in Caenorhabditis elegans.
J Cell Sci 2012 125(Pt 7) 1716-26 
[ PubMed ID = 22328524 ] [ RRC reference ]

SenGupta T, Torgersen ML, Kassahun H, Vellai T, Simonsen A, Nilsen H.
Base excision repair AP endonucleases and mismatch repair act together to induce checkpoint-mediated autophagy.
Nat Commun 2013 4 2674 
[ PubMed ID = 24154628 ] [ RRC reference ]

Moriwaki T, Kato Y, Nakamura C, Ishikawa S, Zhang-Akiyama QM.
A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells.
Genes Cancer 2015 6(7-8) 341-55 
[ PubMed ID = 26413217 ] [ RRC reference ]

Lawrence KS, Chau T, Engebrecht J.
DNA damage response and spindle assembly checkpoint function throughout the cell cycle to ensure genomic integrity.
PLoS Genet 2015 11(4) e1005150 
[ PubMed ID = 25898113 ] [ RRC reference ]

Ermolaeva MA, Segref A, Dakhovnik A, Ou HL, Schneider JI, Utermöhlen O, Hoppe T, Schumacher B.
DNA damage in germ cells induces an innate immune response that triggers systemic stress resistance.
Nature 2013 501(7467) 416-20 
[ PubMed ID = 23975097 ] [ RRC reference ]