Allele Name | tm852 |
Sequence Name | C02C6.1 |
CGC Name | dyn-1 |
Worm Base | Allele Name |
tm852
|
CGC Name |
dyn-1
|
Sequence |
C02C6.1
|
Phenotype | Lethal or sterile. Dr. Z. Zhou: arrests at L1 stage, does not bear any persistent cell corpses at 4-fold embryonic stage or arrested L1 stage. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. M. Hengartner: no engulfment defects, early L1 lethal. |
Mutation site | 35638/35639-TGGA-36326/36327 (688 bp deletion + 4 bp insertion) |
Chromosome | X |
Putative gene structure | join(34447..34613, 34679..34902, 35084..35690, 35736..36239, 36287..36562, 37097..37376, 37481..37866, 38040..38088) |
Map position | 22.85 |
Balancer | Not Yet Balanced |
Map position of balancer | |
Sequence of primers | IntFwd:GACTGCGAGGCTGACTCACT,ExtRev:AGTGAGAGCCAGCCCTTTCT,IntRev:CTGATCACCTGGTTTCCAAG,ExtFwd:CTTTTTCTCTCCCCGCCGCA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Yu X, Odera S, Chuang CH, Lu N, Zhou Z. C. elegans Dynamin mediates the signaling of phagocytic receptor CED-1 for the engulfment and degradation of apoptotic cells. Dev Cell 2006 10(6) 743-57
[ PubMed ID = 16740477 ]
[ RRC reference ]
|
|