Mutants (Isolated)

tm852

Allele Nametm852
Sequence NameC02C6.1
CGC Namedyn-1
Worm BaseAllele Name tm852
CGC Name dyn-1
Sequence C02C6.1
PhenotypeLethal or sterile. Dr. Z. Zhou: arrests at L1 stage, does not bear any persistent cell corpses at 4-fold embryonic stage or arrested L1 stage. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. M. Hengartner: no engulfment defects, early L1 lethal.
Mutation site35638/35639-TGGA-36326/36327 (688 bp deletion + 4 bp insertion)
ChromosomeX
Putative gene structurejoin(34447..34613, 34679..34902, 35084..35690, 35736..36239, 36287..36562, 37097..37376, 37481..37866, 38040..38088)
Map position22.85
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntFwd:GACTGCGAGGCTGACTCACT,ExtRev:AGTGAGAGCCAGCCCTTTCT,IntRev:CTGATCACCTGGTTTCCAAG,ExtFwd:CTTTTTCTCTCCCCGCCGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yu X, Odera S, Chuang CH, Lu N, Zhou Z.
C. elegans Dynamin mediates the signaling of phagocytic receptor CED-1 for the engulfment and degradation of apoptotic cells.
Dev. Cell 2006 10(6) 743-57 
[ PubMed ID = 16740477 ] [ RRC reference ]