| Allele Name | tm849 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C48B6.6 |
| Gene Name | smg-1 |
| Worm Base | Allele Name |
tm849
|
| Gene Name |
smg-1
|
| Sequence |
C48B6.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| Homozygous viable. Dr. J. Kaplan: type movement, nonEgl. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 21010/21011-21535/21536 (525 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(14982..15059, 15139..15272, 15317..15414, 15488..15568, 15689..15849, 15925..16012, 16090..16442, 16547..16843, 16892..16996, 17083..17320, 17421..17569, 17615..17698, 17941..18111, 18156..18440, 18487..18665, 19214..19334, 19388..19532, 19578..19873, 19977..20122, 20169..20453, 20549..20814, 21006..21146, 21219..21328, 21376..21463, 21514..21743, 21825..21932, 21974..22197, 22272..22474, 22520..22647)) |
| Map position | 1.48 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GGTTTGGCTGAATCGAGTAT,ExtRev:ACGCAGCAAGTTGTGAGGTT,IntFwd:CCATCTGGCCATTTTGAGAT,ExtFwd:GCGATTTCATATGCCCATCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV. The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction. Geroscience 2024 46(5) 4827-4854
[ PubMed ID = 38878153 ]
[ RRC reference ]
|
Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV. The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction. bioRxiv 2023
[ PubMed ID = 38045350 ]
[ RRC reference ]
|
Kim EJE, Son HG, Park HH, Jung Y, Kwon S, Lee SV. Caenorhabditis elegans algn-2 Is Critical for Longevity Conferred by Enhanced Nonsense-Mediated mRNA Decay. iScience 2020 23(11) 101713
[ PubMed ID = 33225240 ]
[ RRC reference ]
|
Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ. RNA surveillance is required for endoplasmic reticulum homeostasis. Proc Natl Acad Sci U S A 2012 109(21) 8079-84
[ PubMed ID = 22562797 ]
[ RRC reference ]
|
|