Mutants (Isolated)

tm849

Allele Nametm849
Sequence NameC48B6.6
CGC Namesmg-1
Worm BaseAllele Name tm849
CGC Name smg-1
Sequence C48B6.6
PhenotypeHomozygous viable. Dr. J. Kaplan: type movement, nonEgl.
Mutation site21010/21011-21535/21536 (525 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(14982..15059, 15139..15272, 15317..15414, 15488..15568, 15689..15849, 15925..16012, 16090..16442, 16547..16843, 16892..16996, 17083..17320, 17421..17569, 17615..17698, 17941..18111, 18156..18440, 18487..18665, 19214..19334, 19388..19532, 19578..19873, 19977..20122, 20169..20453, 20549..20814, 21006..21146, 21219..21328, 21376..21463, 21514..21743, 21825..21932, 21974..22197, 22272..22474, 22520..22647))
Map position1.48
Balancer
Map position of balancer
Sequence of primersIntRev:GGTTTGGCTGAATCGAGTAT,ExtRev:ACGCAGCAAGTTGTGAGGTT,IntFwd:CCATCTGGCCATTTTGAGAT,ExtFwd:GCGATTTCATATGCCCATCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ.
RNA surveillance is required for endoplasmic reticulum homeostasis.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(21) 8079-84 
[ PubMed ID = 22562797 ] [ RRC reference ]