分離済み変異体

tm8478

Allele Nametm8478
BalanceNot Required
OutCrossRequest Available
Sequence NameY46H3B.1 F36H9.3 F36H9.8 F36H9.7 F36H9.4 F36H9.5 F36H9.2 F36H9.1 F36H9.6 Y46H3A.3 Y46H3A.2 Y46H3A.1 Y46H3A.4 Y46H3A.5 Y46H3A.6
Gene NameY46H3B.1 F36H9.3 F36H9.8 F36H9.7 F36H9.4 F36H9.5 F36H9.2 F36H9.1 F36H9.6 Y46H3A.3 Y46H3A.2 Y46H3A.1 Y46H3A.4 Y46H3A.5 Y46H3A.6
Worm BaseAllele Name tm8478
Gene Name Y46H3B.1 F36H9.3 F36H9.8 F36H9.7 F36H9.4 F36H9.5 F36H9.2 F36H9.1 F36H9.6 Y46H3A.3 Y46H3A.2 Y46H3A.1 Y46H3A.4 Y46H3A.5 Y46H3A.6
Sequence Y46H3B.1 F36H9.3 F36H9.8 F36H9.7 F36H9.4 F36H9.5 F36H9.2 F36H9.1 F36H9.6 Y46H3A.3 Y46H3A.2 Y46H3A.1 Y46H3A.4 Y46H3A.5 Y46H3A.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [Y46H3B]5133/5134-[Y46H3A]16312/16313 (56427 bp deletion)
ChromosomeV
Putative gene structureY46H3B.1 = join(4739..4861, 5675..5819, 5874..5978, 6024..6172, 6487..6701, 6750..6848, 6901..7139, 7981..8146, 8228..8291, 8657..8780, 8827..9071); F36H9.3= complement(join(175..374, 3169..3595, 4790..4873, 6003..6065)); F36H9.8 = complement(join(6241..6432, 7550..7780)); F36H9.7 = complement(join(8259..8382, 8447..8529, 9083..9256)); F36H9.4 = complement(join(10510..10582, 10962..11341,12765..12842, 13040..13113, 13260..13308, 13455..13469)); F36H9.5 = complement(join(14210..14436, 14655..14775, 14833..14933, 15171..15313, 15356..15492, 15539..15645, 15745..15883, 16272..16355)); F36H9.2 = join(22848..22924, 23042..23126, 23938..24013, 25233..25378, 25523..25592, 25636..25815, 27386..27579); F36H9.1 = join(28385..28476, 28992..29064, 29122..29197, 30437..30582, 30914..30983, 31363..31500, 31592..31767, 32078..32172, 32682..32754, 33101..33176, 33222..33367, 33524..33593, 33643..33813, 33862..34031); F36H9.6 = complement(join(34191..34406, 35262..35413,35472..35789, 35853..35979)); Y46H3A.3 = complement(join(2993..3304, 3351..3476)); join(3823..3960, 4019..4312); Y46H3A.1 = join(6653..6833,6887..7204, 7251..7402, 7658..7861, 7934..8020); complement(join(8202..8362, 9582..9893, 9986..10136, 10606..11073)); complement(join(11240..11280, 11322..11481, 11867..11939, 12000..12050, 12108..12172)); Y46H3A.6 = complement(join(14729..14869, 15792..16232, 16926..17548, 18493..18967, 19669..19744, 19793..19842))
Map position-17.69
Balancer
Map position of balancer
Sequence of primersExtRev:CGACTCTGGAATTCTCTGTA,ExtFwd:CGTGCCGCTGATAAGACATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication