Mutants (Isolated)

tm847

Allele Nametm847
Sequence NameC05D9.1
CGC Namesnx-1
Worm BaseAllele Name tm847
CGC Name snx-1
Sequence C05D9.1
PhenotypeHomozygous viable. Dr. G. Hermann: WT gut granules. Dr. H.C. Korswagen: no QL and QR daughter cells and HSN migration defects, polarity of V5 division defects. Dr. N. Tavernarakis: Egl, slightly bloated. Dr. O. Blacque: dye-filling normal. Dr. X. Wang: cell corpse removed is affected in both somatic and germ cells. Dr. J. Kaplan: wt locomotion and aldicarb sensitivity. Dr. S. Shaham: no obvious defects in amphid function. Dr. B. Grant: EMBO J 28, 3290 (2009).
Mutation site28158/28159-29918/29919 (1760 bp deletion)
ChromosomeX
Putative gene structurejoin(27993..28201, 28586..28721, 28769..28930, 29298..29678, 30002..30478, 31340..31393)
Map position-18.49
Balancer
Map position of balancer
Sequence of primersIntFwd:ACTGCGATGAGATCAACTTG,IntRev:TCTCAGTGACGTCGGTCAGT,ExtFwd:TTGTTCAGCGACGACTGCGA,ExtRev:CATACACAGCAGAGACGTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang D, Isack NR, Glodowski DR, Liu J, Chen CC, Xu XZ, Grant BD, Rongo C.
RAB-6.2 and the retromer regulate glutamate receptor recycling through a retrograde pathway.
J. Cell Biol. 2012 196(1) 85-101 
[ PubMed ID = 22213799 ] [ RRC reference ]

Shi A, Sun L, Banerjee R, Tobin M, Zhang Y, Grant BD.
Regulation of endosomal clathrin and retromer-mediated endosome to Golgi retrograde transport by the J-domain protein RME-8.
EMBO J. 2009 28(21) 3290-302 
[ PubMed ID = 19763082 ] [ RRC reference ]

Beer KB, Rivas-Castillo J, Kuhn K, Fazeli G, Karmann B, Nance JF, Stigloher C, Wehman AM.
Extracellular vesicle budding is inhibited by redundant regulators of TAT-5 flippase localization and phospholipid asymmetry.
Proc. Natl. Acad. Sci. U.S.A. 2018 115(6) E1127-E1136 
[ PubMed ID = 29367422 ] [ RRC reference ]

Dang H, Klokk TI, Schaheen B, McLaughlin BM, Thomas AJ, Durns TA, Bitler BG, Sandvig K, Fares H.
Derlin-dependent retrograde transport from endosomes to the Golgi apparatus.
Traffic 2011 12(10) 1417-31 
[ PubMed ID = 21722281 ] [ RRC reference ]

Norris A, Tammineni P, Wang S, Gerdes J, Murr A, Kwan KY, Cai Q, Grant BD.
SNX-1 and RME-8 oppose the assembly of HGRS-1/ESCRT-0 degradative microdomains on endosomes.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(3) E307-E316 
[ PubMed ID = 28053230 ] [ RRC reference ]

Gleason RJ, Akintobi AM, Grant BD, Padgett RW.
BMP signaling requires retromer-dependent recycling of the type I receptor.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(7) 2578-83 
[ PubMed ID = 24550286 ] [ RRC reference ]

Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van Weering JRT, van Heesbeen RGHP, Middelkoop TC, Basler K, Cullen PJ, Korswagen HC.
A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion.
Nat. Cell Biol. 2011 13(8) 914-923 
[ PubMed ID = 21725319 ] [ RRC reference ]

Chen D, Xiao H, Zhang K, Wang B, Gao Z, Jian Y, Qi X, Sun J, Miao L, Yang C.
Retromer is required for apoptotic cell clearance by phagocytic receptor recycling.
Science 2010 327(5970) 1261-4 
[ PubMed ID = 20133524 ] [ RRC reference ]

Hermann GJ, Schroeder LK, Hieb CA, Kershner AM, Rabbitts BM, Fonarev P, Grant BD, Priess JR.
Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Mol. Biol. Cell 2005 16(7) 3273-88 
[ PubMed ID = 15843430 ] [ RRC reference ]

Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N.
Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.
Cell. Mol. Life Sci. 2018 75(11) 2027-2044 
[ PubMed ID = 29196797 ] [ RRC reference ]

Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC.
Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants.
Cell. Signal. 2014 26(1) 19-31 
[ PubMed ID = 24056045 ] [ RRC reference ]

Oikonomou G, Perens EA, Lu Y, Shaham S.
Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments.
Dev. Biol. 2012 362(1) 42-9 
[ PubMed ID = 22138055 ] [ RRC reference ]

Martínez-Velázquez LA, Ringstad N.
Antagonistic regulation of trafficking to Caenorhabditis elegans sensory cilia by a Retinal Degeneration 3 homolog and retromer.
Proc. Natl. Acad. Sci. U.S.A. 2018 115(3) E438-E447 
[ PubMed ID = 29282322 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol. Biol. Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]