Mutants (Isolated)

tm8373

Allele Nametm8373
BalanceCompleted
OutCrossCompleted
Sequence NameD2013.8 D2013.9 F42A8.1 F42A8.2 F42A8.3 C06C3.1
Gene NameD2013.8 D2013.9 F42A8.1 F42A8.2 F42A8.3 C06C3.1
Worm BaseAllele Name tm8373 (x1)
Gene Name D2013.8 D2013.9 F42A8.1 F42A8.2 F42A8.3 C06C3.1
Sequence D2013.8 D2013.9 F42A8.1 F42A8.2 F42A8.3 C06C3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [D2013]37114/37115-[C06C3]3256/3257 (28378 bp deletion)
ChromosomeII
Putative gene structureD2013.8=join(34445..34518, 34876..35018, 35062..35493, 35542..35636, 35686..36643, 36692..36782, 37361..37736, 37787..38004, 38053..38251, 38303..38740, 38843..38968, 39016..39129); D2013.9= join(39389..39621, 39669..39777, 39823..40470,40520..40940, Z47809.1:99..249, Z47809.1:297..494, Z47809.1:541..769); F42A8.1= complement(join(1108..1482, 2058..2192, 2728..2824, 3841..3965, 4821..4912, 5301..5491, 6018..6115)); F42A8.2=complement(join(10420..10509, 10559..10783, 10956..11084, 11131..11364, 11416..11564, 12212..12281)), F42A8.3=join(12364..12369, 12550..12690, 12738..12866, 12933..13059, 13103..13540, 13589..13722); C06C3.1= join(Z47809.1:18084..18164, Z47809.1:19475..19675, Z47809.1:20240..20794, Z47809.1:21199..21416, 200..529, 1124..1307, 1375..1511, 1896..2159, 3049..3232, 3792..3935, 4129..4329, 5625..5807, 5851..5964, 6014..6181, 6724..6810)
Map position1.28
BalancermIn1 [e128 mIs14]
Map position of balancer
Sequence of primersExtRev:GTTGCGGCACGATTTAATGC,ExtFwd:TCGCAGTGTTACGCGGTCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication