Mutants (Isolated)

tm8341

Allele Nametm8341
BalanceCompleted
OutCrossCompleted
Sequence NameJC8.2 JC8.13 JC8.3 JC8.6 JC8.4 JC8.5 JC8.8 JC8.12 JC8.10
Gene NameJC8.2 JC8.13 JC8.3 JC8.6 JC8.4 JC8.5 JC8.8 JC8.12 JC8.10
Worm BaseAllele Name tm8341 (x1)
Gene Name JC8.2 JC8.13 JC8.3 JC8.6 JC8.4 JC8.5 JC8.8 JC8.12 JC8.10
Sequence JC8.2 JC8.13 JC8.3 JC8.6 JC8.4 JC8.5 JC8.8 JC8.12 JC8.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [JC8]8666/8667-[Y67H2A]5738/5739 (36521 bp deletion)
ChromosomeIV
Putative gene structureJC8.2 = complement(join(7174..7377, 8392..9150, 10178..10618)); JC8.13 = complement(join(11334..11829, 12629..12735, 12794..12924, 13189..13450)); JC8.3 = complement(join(13717..13814, 13864..13971, 14182..14436, 14562..14598)); JC8.6 = join(15106..15231, 15274..15429, 15481..15589, 15636..15741, 15792..16179, 16721..16966, 17021..17197); JC8.4 = 17713..18243; JC8.5 = join(19281..19499, 20668..21036); JC8.7 = join(21314..21482, 22219..22749, 23540..23721, 24412..24531); JC8.8 = complement(join(24757..25110, 26287..26349)); JC8.12 = join(30224..30255, 30875..31012, 31118..31377, 31505..31614, 31990..32058, 32170..32236, 32365..32539, 32950..33046); JC8.10 = complement(join(35907..36340, 37437..37801, 37852..38132, 39258..39553, AL132951.3:105..572, AL132951.3:1728..2386, AL132951.3:3704..3997, AL132951.3:4781..4971, AL132951.3:5708..5937, AL132951.3:6977..7100))
Map position8.48
BalancertmC9[tmIs1221]
Map position of balancer
Sequence of primersExtRev:GAGCTATTGCAACGTTAGGT,ExtFwd:CCAACAGTAACCAGCAATCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cao W, Fan Q, Amparado G, Begic D, Godini R, Gopal S, Pocock R.
A nucleic acid binding protein map of germline regulation in Caenorhabditis elegans.
Nat Commun 2024 15(1) 6884 
[ PubMed ID = 39128930 ] [ RRC reference ]