Mutants (Isolated)

tm8330

Allele Nametm8330
BalanceCompleted
OutCrossCompleted
Sequence NameF01G10.2 F01G10.7 F01G10.1 F01G10.10 F01G10.8 F09G10.9 Y43C5A.1 Y43C5A.2 Y43C5A.3
Gene NameF01G10.2 F01G10.7 F01G10.1 F01G10.10 F01G10.8 F09G10.9 Y43C5A.1 Y43C5A.2 Y43C5A.3
Worm BaseAllele Name tm8330 (x1)
Gene Name F01G10.2 F01G10.7 F01G10.1 F01G10.10 F01G10.8 F09G10.9 Y43C5A.1 Y43C5A.2 Y43C5A.3
Sequence F01G10.2 F01G10.7 F01G10.1 F01G10.10 F01G10.8 F09G10.9 Y43C5A.1 Y43C5A.2 Y43C5A.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [F01G10]10675/10676-[Y43C5A]8168/8169 (38403 bp deletion)
ChromosomeIV
Putative gene structureF01G10.2= complement(join(10534..10717, 10773..10870, 10917..11038, 11366..11792, 11838..11957, 12006..12149, 12200..12355, 12887..12949)), F01G10.7= complement(join(13611..13851, 13900..14381, 14749..15116, 15397..15499, 15553..15639)), F01G10.1= join(17451..17571, 17623..18296, 18343..19117, 19202..19488), F01G10.10= join(20627..20734, 20780..20889, 20939..21061, 21110..21228, 21273..21382, 21431..21493, 22001..22226, 22271..22503, 22553..22654, 22707..22805, 23198..23349, 23396..23510), F01G10.8= join(27501..27510, 27924..28065, 28113..28263, 28330..28842, 29383..29430), F01G10.9= complement(join(29878..29952, 30133..30653, 31112..31239, 31286..31470, 32150..32353, 32401..32497, 33347..33474)), Y43C5A.1= complement(1900..2112), Y43C5A.2= join(2825..2866, 3424..3569, 3618..3750, 3977..4116, 4164..4273, 4318..4453, 4502..4785, 4860..4917, 4966..5025, 5078..5161, 5391..5556), Y43C5A.3= join(7021..7087, 7744..8003)
Map position4.56
BalancertmC5[tmIs1220]
Map position of balancer
Sequence of primersExtRev:CTCCGTGTAACAAAAACGGG,ExtFwd:ACCTCACGGGGTTTATCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication