Mutants (Isolated)

tm807

Allele Nametm807
BalanceNot Required
OutCrossNot Accepted
Sequence NameT05A12.2
Gene Nametre-2
Worm BaseAllele Name tm807
Gene Name tre-2
Sequence T05A12.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 5583/5584-6042/6043 (459 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(4266..4668, 4719..4990, 5038..5254, 5308..5495, 5546..5690, 5740..5853, 5902..5981, 6037..6123, 6173..6312, 6669..6780))
Map position3.25
Balancer
Map position of balancer
Sequence of primersIntFwd:CTCCACCAAGCTCAATGCTA,ExtRev:ACGTGAATTGCCTGTGAGAG,ExtFwd:CCTCCACTTGTTCTCCACAT,IntRev:CAGTCGAGCTGAGAACGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
D'Souza SA, Rajendran L, Bagg R, Barbier L, van Pel DM, Moshiri H, Roy PJ.
The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.
PLoS Genet 2016 12(4) e1006010 
[ PubMed ID = 27123983 ] [ RRC reference ]