分離済み変異体

tm790

Allele Nametm790
BalanceNot Required
OutCrossNot Accepted
Sequence NameF56F3.6
Gene Nameins-17
Worm BaseAllele Name tm790
Gene Name ins-17
Sequence F56F3.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Ashrafi: normal Nile Red staining. Dr. P.W. Sternberg: normal locomotion. Dr. J. Kaplan: normal nile red staining. Dr. Q.L. Ch'ng: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24428/24429-25013/25014 (585 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(24659..24837, 24936..25083))
Map position-3.16
Balancer
Map position of balancer
Sequence of primersIntFwd:GGCCGACTTCAGAAAGTTCA,ExtRev:GACGTGTTGGTCATCCGGCA,ExtFwd:GAGACTTGAACAACTCTGAG,IntRev:ATGGATCCGCCAACCCGGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S.
A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(21) e2406565121 
[ PubMed ID = 38753507 ] [ RRC reference ]

Banerjee N, Rojas Palato EJ, Shih PY, Sternberg PW, Hallem EA.
Distinct neurogenetic mechanisms establish the same chemosensory valence state at different life stages in Caenorhabditis elegans.
G3 (Bethesda) 2024 14(2)  
[ PubMed ID = 38092065 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178 
[ PubMed ID = 35511794 ] [ RRC reference ]

Guillermin ML, Carrillo MA, Hallem EA.
A Single Set of Interneurons Drives Opposite Behaviors in C. elegans.
Curr Biol 2017 27(17) 2630-2639.e6 
[ PubMed ID = 28823678 ] [ RRC reference ]

Lim MA, Chitturi J, Laskova V, Meng J, Findeis D, Wiekenberg A, Mulcahy B, Luo L, Li Y, Lu Y, Hung W, Qu Y, Ho CY, Holmyard D, Ji N, McWhirter R, Samuel AD, Miller DM, Schnabel R, Calarco JA, Zhen M.
Neuroendocrine modulation sustains the C. elegans forward motor state.
Elife 2016 5  
[ PubMed ID = 27855782 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]

Matsunaga Y, Nakajima K, Gengyo-Ando K, Mitani S, Iwasaki T, Kawano T.
A Caenorhabditis elegans insulin-like peptide, INS-17: its physiological function and expression pattern.
Biosci Biotechnol Biochem 2012 76(11) 2168-72 
[ PubMed ID = 23132577 ] [ RRC reference ]