Mutants (Isolated)

tm790

Allele Nametm790
Sequence NameF56F3.6
CGC Nameins-17
Worm BaseAllele Name tm790
CGC Name ins-17
Sequence F56F3.6
Phenotypehomozygous viable. Dr. K. Ashrafi: normal Nile Red staining. Dr. P.W. Sternberg: normal locomotion. Dr. J. Kaplan: normal nile red staining. Dr. Q.L. Ch'ng: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.
Mutation site24428/24429-25013/25014 (585 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(24659..24837, 24936..25083))
Map position-3.16
Balancer
Map position of balancer
Sequence of primersIntFwd:GGCCGACTTCAGAAAGTTCA,ExtRev:GACGTGTTGGTCATCCGGCA,ExtFwd:GAGACTTGAACAACTCTGAG,IntRev:ATGGATCCGCCAACCCGGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lim MA, Chitturi J, Laskova V, Meng J, Findeis D, Wiekenberg A, Mulcahy B, Luo L, Li Y, Lu Y, Hung W, Qu Y, Ho CY, Holmyard D, Ji N, McWhirter R, Samuel AD, Miller DM, Schnabel R, Calarco JA, Zhen M.
Neuroendocrine modulation sustains the C. elegans forward motor state.
Elife 2016 5  
[ PubMed ID = 27855782 ] [ RRC reference ]

Matsunaga Y, Nakajima K, Gengyo-Ando K, Mitani S, Iwasaki T, Kawano T.
A Caenorhabditis elegans insulin-like peptide, INS-17: its physiological function and expression pattern.
Biosci Biotechnol Biochem 2012 76(11) 2168-72 
[ PubMed ID = 23132577 ] [ RRC reference ]

Guillermin ML, Carrillo MA, Hallem EA.
A Single Set of Interneurons Drives Opposite Behaviors in C. elegans.
Curr Biol 2017 27(17) 2630-2639.e6 
[ PubMed ID = 28823678 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]