Mutants (Isolated)

tm783

Allele Nametm783
Sequence NameC15F1.7
CGC Namesod-1
Worm BaseAllele Name tm783
CGC Name sod-1
Sequence C15F1.7
Phenotypehomozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: slightly short life span, dauer arrest abnormal. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site17789/17790-18319/18320 (530 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17270..17367, 17412..17565, 17610..17768, 17812..17895, 18227..18274))
Map position0.2
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGGCACAACATTTATGGCA,ExtFwd:TCTCCGTCAGAACTTGTTGA,ExtRev:AGAGGCCCTCCTCTCATTGT,IntRev:GGGGTCAAGGGGTCAAAGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yanase S, Onodera A, Tedesco P, Johnson TE, Ishii N.
SOD-1 deletions in Caenorhabditis elegans alter the localization of intracellular reactive oxygen species and show molecular compensation.
J. Gerontol. A Biol. Sci. Med. Sci. 2009 64(5) 530-9 
[ PubMed ID = 19282511 ] [ RRC reference ]

Yee C, Yang W, Hekimi S.
The intrinsic apoptosis pathway mediates the pro-longevity response to mitochondrial ROS in C. elegans.
Cell 2014 157(4) 897-909 
[ PubMed ID = 24813612 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(15) 5785-90 
[ PubMed ID = 22451939 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet. 2015 11(2) e1004972 
[ PubMed ID = 25671321 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet. 2009 5(2) e1000361 
[ PubMed ID = 19197346 ] [ RRC reference ]