分離済み変異体

tm783

Allele Name

tm783

Allele Type

通常株

Sequence Name

C15F1.7

Gene Name

sod-1

Worm Base

Allele Name

tm783

Gene Name

sod-1

Sequence

C15F1.7

Phenotype

homozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: slightly short life span, dauer arrest abnormal. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).

Mutation site

17789/17790-18319/18320 (530 bp deletion)

Chromosome

Putative gene structure

complement(join(17270..17367, 17412..17565, 17610..17768, 17812..17895, 18227..18274))

Map position

0.2

Balancer

Map position of balancer

Sequence of primers

IntFwd:CTGGCACAACATTTATGGCA,ExtFwd:TCTCCGTCAGAACTTGTTGA,ExtRev:AGAGGCCCTCCTCTCATTGT,IntRev:GGGGTCAAGGGGTCAAAGTT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C.
ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans.
PLoS Biol 2022 20(6) e3001684
[ PubMed ID = 35727855 ] [ RRC reference ]

Branicky R, Wang Y, Khaki A, Liu JL, Kramer-Drauberg M, Hekimi S.
Stimulation of RAS-dependent ROS signaling extends longevity by modulating a developmental program of global gene expression.
Sci Adv 2022 8(48) eadc9851
[ PubMed ID = 36449615 ] [ RRC reference ]

Gaidamakova EK, Sharma A, Matrosova VY, Grichenko O, Volpe RP, Tkavc R, Conze IH, Klimenkova P, Balygina I, Horne WH, Gostinčar C, Chen X, Makarova KS, Shuryak I, Srinivasan C, Jackson-Thompson B, Hoffman BM, Daly MJ.
Small-Molecule Mn Antioxidants in Caenorhabditis elegans and Deinococcus radiodurans Supplant MnSOD Enzymes during Aging and Irradiation.
mBio 2022 13(1) e0339421
[ PubMed ID = 35012337 ] [ RRC reference ]

Fernando LM, Adeel S, Basar MA, Allen AK, Duttaroy A.
In-gel SOD assay reveals SOD-2 is the single active, water-soluble SOD enzyme in C. elegans.
Free Radic Res 2021 55(6) 619-624
[ PubMed ID = 34514925 ] [ RRC reference ]

Kramer-Drauberg M, Liu JL, Desjardins D, Wang Y, Branicky R, Hekimi S.
ROS regulation of RAS and vulva development in Caenorhabditis elegans.
PLoS Genet 2020 16(6) e1008838
[ PubMed ID = 32544191 ] [ RRC reference ]

Dues DJ, Andrews EK, Senchuk MM, Van Raamsdonk JM.
Resistance to Stress Can Be Experimentally Dissociated From Longevity.
J Gerontol A Biol Sci Med Sci 2019 74(8) 1206-1214
[ PubMed ID = 30247515 ] [ RRC reference ]

Desjardins D, Cacho-Valadez B, Liu JL, Wang Y, Yee C, Bernard K, Khaki A, Breton L, Hekimi S.
Antioxidants reveal an inverted U-shaped dose-response relationship between reactive oxygen species levels and the rate of aging in Caenorhabditis elegans.
Aging Cell 2017 16(1) 104-112
[ PubMed ID = 27683245 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet 2015 11(2) e1004972
[ PubMed ID = 25671321 ] [ RRC reference ]

Yee C, Yang W, Hekimi S.
The intrinsic apoptosis pathway mediates the pro-longevity response to mitochondrial ROS in C. elegans.
Cell 2014 157(4) 897-909
[ PubMed ID = 24813612 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc Natl Acad Sci U S A 2012 109(15) 5785-90
[ PubMed ID = 22451939 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet 2009 5(2) e1000361
[ PubMed ID = 19197346 ] [ RRC reference ]

Yanase S, Onodera A, Tedesco P, Johnson TE, Ishii N.
SOD-1 deletions in Caenorhabditis elegans alter the localization of intracellular reactive oxygen species and show molecular compensation.
J Gerontol A Biol Sci Med Sci 2009 64(5) 530-9
[ PubMed ID = 19282511 ] [ RRC reference ]