Mutants (Isolated)

tm783

Allele Name

tm783

Sequence Name

C15F1.7

CGC Name

sod-1

Worm Base

Allele Name

tm783

CGC Name

sod-1

Sequence

C15F1.7

Phenotype

homozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: slightly short life span, dauer arrest abnormal. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).

Mutation site

17789/17790-18319/18320 (530 bp deletion)

Chromosome

Putative gene structure

complement(join(17270..17367, 17412..17565, 17610..17768, 17812..17895, 18227..18274))

Map position

0.2

Balancer

Map position of balancer

Sequence of primers

IntFwd:CTGGCACAACATTTATGGCA,ExtFwd:TCTCCGTCAGAACTTGTTGA,ExtRev:AGAGGCCCTCCTCTCATTGT,IntRev:GGGGTCAAGGGGTCAAAGTT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Kramer-Drauberg M, Liu JL, Desjardins D, Wang Y, Branicky R, Hekimi S.
ROS regulation of RAS and vulva development in Caenorhabditis elegans.
PLoS Genet 2020 16(6) e1008838
[ PubMed ID = 32544191 ] [ RRC reference ]

Dues DJ, Andrews EK, Senchuk MM, Van Raamsdonk JM.
Resistance to Stress Can Be Experimentally Dissociated From Longevity.
J Gerontol A Biol Sci Med Sci 2019 74(8) 1206-1214
[ PubMed ID = 30247515 ] [ RRC reference ]

Desjardins D, Cacho-Valadez B, Liu JL, Wang Y, Yee C, Bernard K, Khaki A, Breton L, Hekimi S.
Antioxidants reveal an inverted U-shaped dose-response relationship between reactive oxygen species levels and the rate of aging in Caenorhabditis elegans.
Aging Cell 2017 16(1) 104-112
[ PubMed ID = 27683245 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet 2015 11(2) e1004972
[ PubMed ID = 25671321 ] [ RRC reference ]

Yee C, Yang W, Hekimi S.
The intrinsic apoptosis pathway mediates the pro-longevity response to mitochondrial ROS in C. elegans.
Cell 2014 157(4) 897-909
[ PubMed ID = 24813612 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc Natl Acad Sci U S A 2012 109(15) 5785-90
[ PubMed ID = 22451939 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet 2009 5(2) e1000361
[ PubMed ID = 19197346 ] [ RRC reference ]

Yanase S, Onodera A, Tedesco P, Johnson TE, Ishii N.
SOD-1 deletions in Caenorhabditis elegans alter the localization of intracellular reactive oxygen species and show molecular compensation.
J Gerontol A Biol Sci Med Sci 2009 64(5) 530-9
[ PubMed ID = 19282511 ] [ RRC reference ]