Mutants (Isolated)

tm776

Allele Nametm776
Allele TypeNormal
Sequence NameC15F1.7
Gene Namesod-1
Worm BaseAllele Name tm776
Gene Name sod-1
Sequence C15F1.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: slightly short life span on 20C, dauer arrest abnormal. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).Dr. O. Hobert: Nat. Neurosci. 11, 894 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17154/17155-17766/17767 (612 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17270..17367, 17412..17565, 17610..17768, 17812..17895, 18227..18274))
Map position0.2
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGGCACAACATTTATGGCA,ExtFwd:TCTCCGTCAGAACTTGTTGA,ExtRev:AGAGGCCCTCCTCTCATTGT,IntRev:GGGGTCAAGGGGTCAAAGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wong CH, Haque MA, Chang HC.
Superoxide dismutase SOD-3 regulates redox homeostasis in the intestine.
MicroPubl Biol 2023 2023  
[ PubMed ID = 38188420 ] [ RRC reference ]

Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Wong CH, Rahat A, Chang HC.
Fused in sarcoma regulates glutamate signaling and oxidative stress response.
Free Radic Biol Med 2024 210 172-182 
[ PubMed ID = 38007141 ] [ RRC reference ]

Chen H, Li R, Zhao F, Luan L, Han T, Li Z.
Betulinic acid increases lifespan and stress resistance via insulin/IGF-1 signaling pathway in Caenorhabditis elegans.
Front Nutr 2022 9 960239 
[ PubMed ID = 35967806 ] [ RRC reference ]

Yu CY, Chang HC.
Glutamate signaling mediates C. elegans behavioral plasticity to pathogens.
iScience 2022 25(3) 103919 
[ PubMed ID = 35252815 ] [ RRC reference ]

Hershberger KA, Rooney JP, Turner EA, Donoghue LJ, Bodhicharla R, Maurer LL, Ryde IT, Kim JJ, Joglekar R, Hibshman JD, Smith LL, Bhatt DP, Ilkayeva OR, Hirschey MD, Meyer JN.
Early-life mitochondrial DNA damage results in lifelong deficits in energy production mediated by redox signaling in Caenorhabditis elegans.
Redox Biol 2021 43 102000 
[ PubMed ID = 33993056 ] [ RRC reference ]

Fernando LM, Adeel S, Basar MA, Allen AK, Duttaroy A.
In-gel SOD assay reveals SOD-2 is the single active, water-soluble SOD enzyme in C. elegans.
Free Radic Res 2021 55(6) 619-624 
[ PubMed ID = 34514925 ] [ RRC reference ]

Yanase S, Yasuda K, Ishii N.
Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans.
Biochem Biophys Rep 2020 23 100796 
[ PubMed ID = 32875124 ] [ RRC reference ]

Tjahjono E, McAnena AP, Kirienko NV.
The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage.
BMC Biol 2020 18(1) 74 
[ PubMed ID = 32600387 ] [ RRC reference ]

Kelley CA, De Henau S, Bell L, Dansen TB, Cram EJ.
Redox signaling modulates Rho activity and tissue contractility in the Caenorhabditis elegans spermatheca.
Mol Biol Cell 2020 31(14) 1486-1497 
[ PubMed ID = 32374641 ] [ RRC reference ]

Yanase S, Yasuda K, Ishii N.
Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans.
Biochem Biophys Rep 2020 23 100796 
[ PubMed ID = 32875124 ] [ RRC reference ]

Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]

Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)  
[ PubMed ID = 31771156 ] [ RRC reference ]

Baskoylu SN, Yersak J, O'Hern P, Grosser S, Simon J, Kim S, Schuch K, Dimitriadi M, Yanagi KS, Lins J, Hart AC.
Single copy/knock-in models of ALS SOD1 in C. elegans suggest loss and gain of function have different contributions to cholinergic and glutamatergic neurodegeneration.
PLoS Genet 2018 14(10) e1007682 
[ PubMed ID = 30296255 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]

Nam YW, Baskoylu SN, Gazgalis D, Orfali R, Cui M, Hart AC, Zhang M.
A V-to-F substitution in SK2 channels causes Ca2+ hypersensitivity and improves locomotion in a C. elegans ALS model.
Sci Rep 2018 8(1) 10749 
[ PubMed ID = 30013223 ] [ RRC reference ]

Luz AL, Godebo TR, Bhatt DP, Ilkayeva OR, Maurer LL, Hirschey MD, Meyer JN.
From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.
Toxicol Sci 2016 152(2) 349-62 
[ PubMed ID = 27208080 ] [ RRC reference ]

Xu S, Chisholm AD.
Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG.
Sci Rep 2016 6 21271 
[ PubMed ID = 26861262 ] [ RRC reference ]

Na HS, Brockway NL, Gentry KR, Opheim E, Sedensky MM, Morgan PG.
The genetics of isoflurane-induced developmental neurotoxicity.
Neurotoxicol Teratol 2017 60 40-49 
[ PubMed ID = 27989695 ] [ RRC reference ]

Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]