Mutants (Isolated)

tm776

Allele Nametm776
Sequence NameC15F1.7
CGC Namesod-1
Worm BaseAllele Name tm776
CGC Name sod-1
Sequence C15F1.7
Phenotypehomozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: slightly short life span on 20C, dauer arrest abnormal. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).Dr. O. Hobert: Nat. Neurosci. 11, 894 (2008).
Mutation site17154/17155-17766/17767 (612 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17270..17367, 17412..17565, 17610..17768, 17812..17895, 18227..18274))
Map position0.2
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGGCACAACATTTATGGCA,ExtFwd:TCTCCGTCAGAACTTGTTGA,ExtRev:AGAGGCCCTCCTCTCATTGT,IntRev:GGGGTCAAGGGGTCAAAGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kelley CA, De Henau S, Bell L, Dansen TB, Cram EJ.
Redox signaling modulates Rho activity and tissue contractility in the Caenorhabditis elegans spermatheca.
Mol Biol Cell 2020 31(14) 1486-1497 
[ PubMed ID = 32374641 ] [ RRC reference ]

Baskoylu SN, Yersak J, O'Hern P, Grosser S, Simon J, Kim S, Schuch K, Dimitriadi M, Yanagi KS, Lins J, Hart AC.
Single copy/knock-in models of ALS SOD1 in C. elegans suggest loss and gain of function have different contributions to cholinergic and glutamatergic neurodegeneration.
PLoS Genet 2018 14(10) e1007682 
[ PubMed ID = 30296255 ] [ RRC reference ]

Nam YW, Baskoylu SN, Gazgalis D, Orfali R, Cui M, Hart AC, Zhang M.
A V-to-F substitution in SK2 channels causes Ca2+ hypersensitivity and improves locomotion in a C. elegans ALS model.
Sci Rep 2018 8(1) 10749 
[ PubMed ID = 30013223 ] [ RRC reference ]

Xu S, Chisholm AD.
Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG.
Sci Rep 2016 6 21271 
[ PubMed ID = 26861262 ] [ RRC reference ]

Na HS, Brockway NL, Gentry KR, Opheim E, Sedensky MM, Morgan PG.
The genetics of isoflurane-induced developmental neurotoxicity.
Neurotoxicol Teratol 2017 60 40-49 
[ PubMed ID = 27989695 ] [ RRC reference ]

Yanase S, Yasuda K, Ishii N.
Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans.
Biochem Biophys Rep 2020 23 100796 
[ PubMed ID = 32875124 ] [ RRC reference ]

Sakamoto T, Imai H.
Hydrogen peroxide produced by superoxide dismutase SOD-2 activates sperm in Caenorhabditis elegans.
J Biol Chem 2017 292(36) 14804-14813 
[ PubMed ID = 28724632 ] [ RRC reference ]

Williams DC, Bejjani RE, Ramirez PM, Coakley S, Kim SA, Lee H, Wen Q, Samuel A, Lu H, Hilliard MA, Hammarlund M.
Rapid and permanent neuronal inactivation in vivo via subcellular generation of reactive oxygen with the use of KillerRed.
Cell Rep 2013 5(2) 553-63 
[ PubMed ID = 24209746 ] [ RRC reference ]

Leitch JM, Li CX, Baron JA, Matthews LM, Cao X, Hart PJ, Culotta VC.
Post-translational modification of Cu/Zn superoxide dismutase under anaerobic conditions.
Biochemistry 2012 51(2) 677-85 
[ PubMed ID = 22148750 ] [ RRC reference ]

Tjahjono E, McAnena AP, Kirienko NV.
The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage.
BMC Biol 2020 18(1) 74 
[ PubMed ID = 32600387 ] [ RRC reference ]

Luz AL, Godebo TR, Bhatt DP, Ilkayeva OR, Maurer LL, Hirschey MD, Meyer JN.
From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.
Toxicol Sci 2016 152(2) 349-62 
[ PubMed ID = 27208080 ] [ RRC reference ]

Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)  
[ PubMed ID = 31771156 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]

Le TT, Duren HM, Slipchenko MN, Hu CD, Cheng JX.
Label-free quantitative analysis of lipid metabolism in living Caenorhabditis elegans.
J Lipid Res 2010 51(3) 672-7 
[ PubMed ID = 19776402 ] [ RRC reference ]

Yang Y, Han SM, Miller MA.
MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling.
Dev Biol 2010 342(1) 96-107 
[ PubMed ID = 20380830 ] [ RRC reference ]

Labuschagne CF, Stigter EC, Hendriks MM, Berger R, Rokach J, Korswagen HC, Brenkman AB.
Quantification of in vivo oxidative damage in Caenorhabditis elegans during aging by endogenous F3-isoprostane measurement.
Aging Cell 2013 12(2) 214-23 
[ PubMed ID = 23279719 ] [ RRC reference ]

Wu Q, Zhao Y, Li Y, Wang D.
Molecular signals regulating translocation and toxicity of graphene oxide in the nematode Caenorhabditis elegans.
Nanoscale 2014 6(19) 11204-12 
[ PubMed ID = 25124895 ] [ RRC reference ]

Rangaraju S, Solis GM, Andersson SI, Gomez-Amaro RL, Kardakaris R, Broaddus CD, Niculescu AB 3rd, Petrascheck M.
Atypical antidepressants extend lifespan of Caenorhabditis elegans by activation of a non-cell-autonomous stress response.
Aging Cell 2015 14(6) 971-81 
[ PubMed ID = 26255886 ] [ RRC reference ]

Lu T, Aron L, Zullo J, Pan Y, Kim H, Chen Y, Yang TH, Kim HM, Drake D, Liu XS, Bennett DA, Colaiácovo MP, Yankner BA.
REST and stress resistance in ageing and Alzheimer's disease.
Nature 2014 507(7493) 448-54 
[ PubMed ID = 24670762 ] [ RRC reference ]

Xu S, Chisholm AD.
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair.
Dev Cell 2014 31(1) 48-60 
[ PubMed ID = 25313960 ] [ RRC reference ]