Mutants (Isolated)

tm776

Allele Nametm776
Sequence NameC15F1.7
CGC Namesod-1
Worm BaseAllele Name tm776
CGC Name sod-1
Sequence C15F1.7
Phenotypehomozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: slightly short life span on 20C, dauer arrest abnormal. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).Dr. O. Hobert: Nat. Neurosci. 11, 894 (2008).
Mutation site17154/17155-17766/17767 (612 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17270..17367, 17412..17565, 17610..17768, 17812..17895, 18227..18274))
Map position0.2
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGGCACAACATTTATGGCA,ExtFwd:TCTCCGTCAGAACTTGTTGA,ExtRev:AGAGGCCCTCCTCTCATTGT,IntRev:GGGGTCAAGGGGTCAAAGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Blaise BJ, Giacomotto J, Triba MN, Toulhoat P, Piotto M, Emsley L, Ségalat L, Dumas ME, Elena B.
Metabolic profiling strategy of Caenorhabditis elegans by whole-organism nuclear magnetic resonance.
J. Proteome Res. 2009 8(5) 2542-50 
[ PubMed ID = 19267476 ] [ RRC reference ]

Blaise BJ, Giacomotto J, Elena B, Dumas ME, Toulhoat P, Ségalat L, Emsley L.
Metabotyping of Caenorhabditis elegans reveals latent phenotypes.
Proc. Natl. Acad. Sci. U.S.A. 2007 104(50) 19808-12 
[ PubMed ID = 18077412 ] [ RRC reference ]

Pocock R, Hobert O.
Oxygen levels affect axon guidance and neuronal migration in Caenorhabditis elegans.
Nat. Neurosci. 2008 11(8) 894-900 
[ PubMed ID = 18587389 ] [ RRC reference ]

Leitch JM, Li CX, Baron JA, Matthews LM, Cao X, Hart PJ, Culotta VC.
Post-translational modification of Cu/Zn superoxide dismutase under anaerobic conditions.
Biochemistry 2012 51(2) 677-85 
[ PubMed ID = 22148750 ] [ RRC reference ]

Williams DC, Bejjani RE, Ramirez PM, Coakley S, Kim SA, Lee H, Wen Q, Samuel A, Lu H, Hilliard MA, Hammarlund M.
Rapid and permanent neuronal inactivation in vivo via subcellular generation of reactive oxygen with the use of KillerRed.
Cell Rep 2013 5(2) 553-63 
[ PubMed ID = 24209746 ] [ RRC reference ]

Sakamoto T, Imai H.
Hydrogen peroxide produced by superoxide dismutase SOD-2 activates sperm in Caenorhabditis elegans.
J. Biol. Chem. 2017 292(36) 14804-14813 
[ PubMed ID = 28724632 ] [ RRC reference ]

Jensen LT, Culotta VC.
Activation of CuZn superoxide dismutases from Caenorhabditis elegans does not require the copper chaperone CCS.
J. Biol. Chem. 2005 280(50) 41373-9 
[ PubMed ID = 16234242 ] [ RRC reference ]

Yanase S, Onodera A, Tedesco P, Johnson TE, Ishii N.
SOD-1 deletions in Caenorhabditis elegans alter the localization of intracellular reactive oxygen species and show molecular compensation.
J. Gerontol. A Biol. Sci. Med. Sci. 2009 64(5) 530-9 
[ PubMed ID = 19282511 ] [ RRC reference ]

Lu T, Aron L, Zullo J, Pan Y, Kim H, Chen Y, Yang TH, Kim HM, Drake D, Liu XS, Bennett DA, Colaiácovo MP, Yankner BA.
REST and stress resistance in ageing and Alzheimer's disease.
Nature 2014 507(7493) 448-54 
[ PubMed ID = 24670762 ] [ RRC reference ]

Rangaraju S, Solis GM, Andersson SI, Gomez-Amaro RL, Kardakaris R, Broaddus CD, Niculescu AB 3rd, Petrascheck M.
Atypical antidepressants extend lifespan of Caenorhabditis elegans by activation of a non-cell-autonomous stress response.
Aging Cell 2015 14(6) 971-81 
[ PubMed ID = 26255886 ] [ RRC reference ]

Wu Q, Zhao Y, Li Y, Wang D.
Molecular signals regulating translocation and toxicity of graphene oxide in the nematode Caenorhabditis elegans.
Nanoscale 2014 6(19) 11204-12 
[ PubMed ID = 25124895 ] [ RRC reference ]

Labuschagne CF, Stigter EC, Hendriks MM, Berger R, Rokach J, Korswagen HC, Brenkman AB.
Quantification of in vivo oxidative damage in Caenorhabditis elegans during aging by endogenous F3-isoprostane measurement.
Aging Cell 2013 12(2) 214-23 
[ PubMed ID = 23279719 ] [ RRC reference ]

Yang Y, Han SM, Miller MA.
MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling.
Dev. Biol. 2010 342(1) 96-107 
[ PubMed ID = 20380830 ] [ RRC reference ]

Le TT, Duren HM, Slipchenko MN, Hu CD, Cheng JX.
Label-free quantitative analysis of lipid metabolism in living Caenorhabditis elegans.
J. Lipid Res. 2010 51(3) 672-7 
[ PubMed ID = 19776402 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet. 2009 5(2) e1000361 
[ PubMed ID = 19197346 ] [ RRC reference ]

De Henau S, Tilleman L, Vangheel M, Luyckx E, Trashin S, Pauwels M, Germani F, Vlaeminck C, Vanfleteren JR, Bert W, Pesce A, Nardini M, Bolognesi M, De Wael K, Moens L, Dewilde S, Braeckman BP.
A redox signalling globin is essential for reproduction in Caenorhabditis elegans.
Nat Commun 2015 6 8782 
[ PubMed ID = 26621324 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet. 2015 11(2) e1004972 
[ PubMed ID = 25671321 ] [ RRC reference ]

Xu S, Chisholm AD.
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair.
Dev. Cell 2014 31(1) 48-60 
[ PubMed ID = 25313960 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]

Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]