Mutants (Isolated)

tm760

Allele Nametm760
Sequence NameC08A9.1
CGC Namesod-3
Worm BaseAllele Name tm760
CGC Name sod-3
Sequence C08A9.1
Phenotypehomozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. W.B. Derry: WT morphology. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: normal lifespan on 20C. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site14553/14554-15268/15269 (715 bp deletion)
ChromosomeX
Putative gene structurejoin(14359..14411, 14826..14998, 15047..15183, 15344..15586, 15638..15688)
Map position24.07
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGAAATGTTTGTCGGTGGT,ExtRev:CCAAAGGATCCTGGTTTGCA,IntFwd:CGGTGGTATGCTCGAATATT,IntRev:ACAGGTGGCGATCTTCAAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Salgueiro WG, Goldani BS, Peres TV, Miranda-Vizuete A, Aschner M, da Rocha JBT, Alves D, Ávila DS.
Insights into the differential toxicological and antioxidant effects of 4-phenylchalcogenil-7-chloroquinolines in Caenorhabditis elegans.
Free Radic. Biol. Med. 2017 110 133-141 
[ PubMed ID = 28571752 ] [ RRC reference ]

Lee J, Kwon G, Lim YH.
Elucidating the Mechanism of Weissella-dependent Lifespan Extension in Caenorhabditis elegans.
Sci Rep 2015 5 17128 
[ PubMed ID = 26601690 ] [ RRC reference ]

Dancy BM, Sedensky MM, Morgan PG.
Effects of the mitochondrial respiratory chain on longevity in C. elegans.
Exp. Gerontol. 2014 56 245-55 
[ PubMed ID = 24709342 ] [ RRC reference ]

Gruber J, Ng LF, Fong S, Wong YT, Koh SA, Chen CB, Shui G, Cheong WF, Schaffer S, Wenk MR, Halliwell B.
Mitochondrial changes in ageing Caenorhabditis elegans--what do we learn from superoxide dismutase knockouts?
PLoS ONE 2011 6(5) e19444 
[ PubMed ID = 21611128 ] [ RRC reference ]

Suthammarak W, Somerlot BH, Opheim E, Sedensky M, Morgan PG.
Novel interactions between mitochondrial superoxide dismutases and the electron transport chain.
Aging Cell 2013 12(6) 1132-40 
[ PubMed ID = 23895727 ] [ RRC reference ]

Yee C, Yang W, Hekimi S.
The intrinsic apoptosis pathway mediates the pro-longevity response to mitochondrial ROS in C. elegans.
Cell 2014 157(4) 897-909 
[ PubMed ID = 24813612 ] [ RRC reference ]

Dues DJ, Schaar CE, Johnson BK, Bowman MJ, Winn ME, Senchuk MM, Van Raamsdonk JM.
Uncoupling of oxidative stress resistance and lifespan in long-lived isp-1 mitochondrial mutants in Caenorhabditis elegans.
Free Radic. Biol. Med. 2017 108 362-373 
[ PubMed ID = 28392283 ] [ RRC reference ]

Laranjeiro R, Harinath G, Burke D, Braeckman BP, Driscoll M.
Single swim sessions in C. elegans induce key features of mammalian exercise.
BMC Biol. 2017 15(1) 30 
[ PubMed ID = 28395669 ] [ RRC reference ]

Greer EL, Blanco MA, Gu L, Sendinc E, Liu J, Aristizábal-Corrales D, Hsu CH, Aravind L, He C, Shi Y.
DNA Methylation on N6-Adenine in C. elegans.
Cell 2015 161(4) 868-78 
[ PubMed ID = 25936839 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(15) 5785-90 
[ PubMed ID = 22451939 ] [ RRC reference ]

Rangaraju S, Solis GM, Andersson SI, Gomez-Amaro RL, Kardakaris R, Broaddus CD, Niculescu AB 3rd, Petrascheck M.
Atypical antidepressants extend lifespan of Caenorhabditis elegans by activation of a non-cell-autonomous stress response.
Aging Cell 2015 14(6) 971-81 
[ PubMed ID = 26255886 ] [ RRC reference ]

Labuschagne CF, Stigter EC, Hendriks MM, Berger R, Rokach J, Korswagen HC, Brenkman AB.
Quantification of in vivo oxidative damage in Caenorhabditis elegans during aging by endogenous F3-isoprostane measurement.
Aging Cell 2013 12(2) 214-23 
[ PubMed ID = 23279719 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]

Han Y, Song S, Wu H, Zhang J, Ma E.
Antioxidant enzymes and their role in phoxim and carbaryl stress in Caenorhabditis elegans.
Pestic Biochem Physiol 2017 138 43-50 
[ PubMed ID = 28456303 ] [ RRC reference ]

De Henau S, Tilleman L, Vangheel M, Luyckx E, Trashin S, Pauwels M, Germani F, Vlaeminck C, Vanfleteren JR, Bert W, Pesce A, Nardini M, Bolognesi M, De Wael K, Moens L, Dewilde S, Braeckman BP.
A redox signalling globin is essential for reproduction in Caenorhabditis elegans.
Nat Commun 2015 6 8782 
[ PubMed ID = 26621324 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet. 2015 11(2) e1004972 
[ PubMed ID = 25671321 ] [ RRC reference ]

Xu S, Chisholm AD.
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair.
Dev. Cell 2014 31(1) 48-60 
[ PubMed ID = 25313960 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet. 2009 5(2) e1000361 
[ PubMed ID = 19197346 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]

Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]