Mutants (Isolated)

tm760

Allele Name

tm760

Allele Type

Normal

Sequence Name

C08A9.1

Gene Name

sod-3

Worm Base

Allele Name

tm760

Gene Name

sod-3

Sequence

C08A9.1

Phenotype

homozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. W.B. Derry: WT morphology. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: normal lifespan on 20C. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).

Mutation site

14553/14554-15268/15269 (715 bp deletion)

Chromosome

Putative gene structure

join(14359..14411, 14826..14998, 15047..15183, 15344..15586, 15638..15688)

Map position

24.07

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TGGAAATGTTTGTCGGTGGT,ExtRev:CCAAAGGATCCTGGTTTGCA,IntFwd:CGGTGGTATGCTCGAATATT,IntRev:ACAGGTGGCGATCTTCAAGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhao L, Wu B, Liang S, Min D, Jiang H.
Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans.
Foods 2022 11(24)
[ PubMed ID = 36553826 ] [ RRC reference ]

Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C.
ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans.
PLoS Biol 2022 20(6) e3001684
[ PubMed ID = 35727855 ] [ RRC reference ]

Onukwufor JO, Farooqi MA, Vodičková A, Koren SA, Baldzizhar A, Berry BJ, Beutner G, Porter GA Jr, Belousov V, Grossfield A, Wojtovich AP.
A reversible mitochondrial complex I thiol switch mediates hypoxic avoidance behavior in C. elegans.
Nat Commun 2022 13(1) 2403
[ PubMed ID = 35504873 ] [ RRC reference ]

Huang M, Hong M, Hou X, Zhu C, Chen D, Chen X, Guang S, Feng X.
H3K9me1/2 methylation limits the lifespan of daf-2 mutants in C. elegans.
Elife 2022 11
[ PubMed ID = 36125117 ] [ RRC reference ]

Chen H, Li R, Zhao F, Luan L, Han T, Li Z.
Betulinic acid increases lifespan and stress resistance via insulin/IGF-1 signaling pathway in Caenorhabditis elegans.
Front Nutr 2022 9 960239
[ PubMed ID = 35967806 ] [ RRC reference ]

Branicky R, Wang Y, Khaki A, Liu JL, Kramer-Drauberg M, Hekimi S.
Stimulation of RAS-dependent ROS signaling extends longevity by modulating a developmental program of global gene expression.
Sci Adv 2022 8(48) eadc9851
[ PubMed ID = 36449615 ] [ RRC reference ]

Taylor SKB, Minhas MH, Tong J, Selvaganapathy PR, Mishra RK, Gupta BP.
C. elegans electrotaxis behavior is modulated by heat shock response and unfolded protein response signaling pathways.
Sci Rep 2021 11(1) 3115
[ PubMed ID = 33542359 ] [ RRC reference ]

Tjahjono E, McAnena AP, Kirienko NV.
The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage.
BMC Biol 2020 18(1) 74
[ PubMed ID = 32600387 ] [ RRC reference ]

Pham TTH, Huang WY, Chen CS, Chiu WT, Chuang HS.
Effects of electrotactic exercise and antioxidant EUK-134 on oxidative stress relief in Caenorhabditis elegans.
PLoS One 2021 16(1) e0245474
[ PubMed ID = 33471830 ] [ RRC reference ]

Dues DJ, Andrews EK, Senchuk MM, Van Raamsdonk JM.
Resistance to Stress Can Be Experimentally Dissociated From Longevity.
J Gerontol A Biol Sci Med Sci 2019 74(8) 1206-1214
[ PubMed ID = 30247515 ] [ RRC reference ]

Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, Machiela E, Schaar CE, DeJonge H, Blackwell TK, Van Raamsdonk JM.
Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways.
BMC Biol 2018 16(1) 147
[ PubMed ID = 30563508 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285
[ PubMed ID = 30049781 ] [ RRC reference ]

Luz AL, Godebo TR, Bhatt DP, Ilkayeva OR, Maurer LL, Hirschey MD, Meyer JN.
From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.
Toxicol Sci 2016 152(2) 349-62
[ PubMed ID = 27208080 ] [ RRC reference ]

Desjardins D, Cacho-Valadez B, Liu JL, Wang Y, Yee C, Bernard K, Khaki A, Breton L, Hekimi S.
Antioxidants reveal an inverted U-shaped dose-response relationship between reactive oxygen species levels and the rate of aging in Caenorhabditis elegans.
Aging Cell 2017 16(1) 104-112
[ PubMed ID = 27683245 ] [ RRC reference ]

Hekimi S, Wang Y, Noë A.
Mitochondrial ROS and the Effectors of the Intrinsic Apoptotic Pathway in Aging Cells: The Discerning Killers!
Front Genet 2016 7 161
[ PubMed ID = 27683586 ] [ RRC reference ]

Chuang HS, Kuo WJ, Lee CL, Chu IH, Chen CS.
Exercise in an electrotactic flow chamber ameliorates age-related degeneration in Caenorhabditis elegans.
Sci Rep 2016 6 28064
[ PubMed ID = 27305857 ] [ RRC reference ]

Wei Y, Kenyon C.
Roles for ROS and hydrogen sulfide in the longevity response to germline loss in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2016 113(20) E2832-41
[ PubMed ID = 27140632 ] [ RRC reference ]

Salgueiro WG, Goldani BS, Peres TV, Miranda-Vizuete A, Aschner M, da Rocha JBT, Alves D, Ávila DS.
Insights into the differential toxicological and antioxidant effects of 4-phenylchalcogenil-7-chloroquinolines in Caenorhabditis elegans.
Free Radic Biol Med 2017 110 133-141
[ PubMed ID = 28571752 ] [ RRC reference ]

Han Y, Song S, Wu H, Zhang J, Ma E.
Antioxidant enzymes and their role in phoxim and carbaryl stress in Caenorhabditis elegans.
Pestic Biochem Physiol 2017 138 43-50
[ PubMed ID = 28456303 ] [ RRC reference ]

Laranjeiro R, Harinath G, Burke D, Braeckman BP, Driscoll M.
Single swim sessions in C. elegans induce key features of mammalian exercise.
BMC Biol 2017 15(1) 30
[ PubMed ID = 28395669 ] [ RRC reference ]