Mutants (Isolated)

tm760

Allele Nametm760
Sequence NameC08A9.1
CGC Namesod-3
Worm BaseAllele Name tm760
CGC Name sod-3
Sequence C08A9.1
Phenotypehomozygous viable. Dr. G. Ruvkun: no effect on dauer arrest. Dr. W.B. Derry: WT morphology. Dr. M. Driscoll: no significant effects on aging. Dr. S. Yanase: normal lifespan on 20C. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site14553/14554-15268/15269 (715 bp deletion)
ChromosomeX
Putative gene structurejoin(14359..14411, 14826..14998, 15047..15183, 15344..15586, 15638..15688)
Map position24.07
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGAAATGTTTGTCGGTGGT,ExtRev:CCAAAGGATCCTGGTTTGCA,IntFwd:CGGTGGTATGCTCGAATATT,IntRev:ACAGGTGGCGATCTTCAAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Salgueiro WG, Goldani BS, Peres TV, Miranda-Vizuete A, Aschner M, da Rocha JBT, Alves D, Ávila DS.
Insights into the differential toxicological and antioxidant effects of 4-phenylchalcogenil-7-chloroquinolines in Caenorhabditis elegans.
Free Radic. Biol. Med. 2017 110 133-141 
[ PubMed ID = 28571752 ] [ RRC reference ]

Lee J, Kwon G, Lim YH.
Elucidating the Mechanism of Weissella-dependent Lifespan Extension in Caenorhabditis elegans.
Sci Rep 2015 5 17128 
[ PubMed ID = 26601690 ] [ RRC reference ]

Dancy BM, Sedensky MM, Morgan PG.
Effects of the mitochondrial respiratory chain on longevity in C. elegans.
Exp. Gerontol. 2014 56 245-55 
[ PubMed ID = 24709342 ] [ RRC reference ]

Gruber J, Ng LF, Fong S, Wong YT, Koh SA, Chen CB, Shui G, Cheong WF, Schaffer S, Wenk MR, Halliwell B.
Mitochondrial changes in ageing Caenorhabditis elegans--what do we learn from superoxide dismutase knockouts?
PLoS ONE 2011 6(5) e19444 
[ PubMed ID = 21611128 ] [ RRC reference ]

Suthammarak W, Somerlot BH, Opheim E, Sedensky M, Morgan PG.
Novel interactions between mitochondrial superoxide dismutases and the electron transport chain.
Aging Cell 2013 12(6) 1132-40 
[ PubMed ID = 23895727 ] [ RRC reference ]

Chuang HS, Kuo WJ, Lee CL, Chu IH, Chen CS.
Exercise in an electrotactic flow chamber ameliorates age-related degeneration in Caenorhabditis elegans.
Sci Rep 2016 6 28064 
[ PubMed ID = 27305857 ] [ RRC reference ]

Hekimi S, Wang Y, Noë A.
Mitochondrial ROS and the Effectors of the Intrinsic Apoptotic Pathway in Aging Cells: The Discerning Killers!
Front Genet 2016 7 161 
[ PubMed ID = 27683586 ] [ RRC reference ]

Yee C, Yang W, Hekimi S.
The intrinsic apoptosis pathway mediates the pro-longevity response to mitochondrial ROS in C. elegans.
Cell 2014 157(4) 897-909 
[ PubMed ID = 24813612 ] [ RRC reference ]

Dues DJ, Schaar CE, Johnson BK, Bowman MJ, Winn ME, Senchuk MM, Van Raamsdonk JM.
Uncoupling of oxidative stress resistance and lifespan in long-lived isp-1 mitochondrial mutants in Caenorhabditis elegans.
Free Radic. Biol. Med. 2017 108 362-373 
[ PubMed ID = 28392283 ] [ RRC reference ]

Laranjeiro R, Harinath G, Burke D, Braeckman BP, Driscoll M.
Single swim sessions in C. elegans induce key features of mammalian exercise.
BMC Biol. 2017 15(1) 30 
[ PubMed ID = 28395669 ] [ RRC reference ]

Greer EL, Blanco MA, Gu L, Sendinc E, Liu J, Aristizábal-Corrales D, Hsu CH, Aravind L, He C, Shi Y.
DNA Methylation on N6-Adenine in C. elegans.
Cell 2015 161(4) 868-78 
[ PubMed ID = 25936839 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(15) 5785-90 
[ PubMed ID = 22451939 ] [ RRC reference ]

Rangaraju S, Solis GM, Andersson SI, Gomez-Amaro RL, Kardakaris R, Broaddus CD, Niculescu AB 3rd, Petrascheck M.
Atypical antidepressants extend lifespan of Caenorhabditis elegans by activation of a non-cell-autonomous stress response.
Aging Cell 2015 14(6) 971-81 
[ PubMed ID = 26255886 ] [ RRC reference ]

Labuschagne CF, Stigter EC, Hendriks MM, Berger R, Rokach J, Korswagen HC, Brenkman AB.
Quantification of in vivo oxidative damage in Caenorhabditis elegans during aging by endogenous F3-isoprostane measurement.
Aging Cell 2013 12(2) 214-23 
[ PubMed ID = 23279719 ] [ RRC reference ]

Desjardins D, Cacho-Valadez B, Liu JL, Wang Y, Yee C, Bernard K, Khaki A, Breton L, Hekimi S.
Antioxidants reveal an inverted U-shaped dose-response relationship between reactive oxygen species levels and the rate of aging in Caenorhabditis elegans.
Aging Cell 2017 16(1) 104-112 
[ PubMed ID = -1 ] [ RRC reference ]

Wei Y, Kenyon C.
Roles for ROS and hydrogen sulfide in the longevity response to germline loss in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2016 113(20) E2832-41 
[ PubMed ID = 27140632 ] [ RRC reference ]

Luz AL, Godebo TR, Bhatt DP, Ilkayeva OR, Maurer LL, Hirschey MD, Meyer JN.
From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.
Toxicol Sci. 2016 152(2) 349-62. 
[ PubMed ID = -1 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]

Han Y, Song S, Wu H, Zhang J, Ma E.
Antioxidant enzymes and their role in phoxim and carbaryl stress in Caenorhabditis elegans.
Pestic Biochem Physiol 2017 138 43-50 
[ PubMed ID = 28456303 ] [ RRC reference ]

De Henau S, Tilleman L, Vangheel M, Luyckx E, Trashin S, Pauwels M, Germani F, Vlaeminck C, Vanfleteren JR, Bert W, Pesce A, Nardini M, Bolognesi M, De Wael K, Moens L, Dewilde S, Braeckman BP.
A redox signalling globin is essential for reproduction in Caenorhabditis elegans.
Nat Commun 2015 6 8782 
[ PubMed ID = 26621324 ] [ RRC reference ]