Mutants (Isolated)

tm753

Allele Nametm753
Sequence NameF31B12.1
CGC Nameplc-1
Worm BaseAllele Name tm753
CGC Name plc-1
Sequence F31B12.1
Phenotypehomozygous viable. Dr. V. Maricq: reduced brood size that is a likely result of faulty spermatheca dilation. Dr. H. Baylis: PLoS Genetics 4, e1000043 (2008).
Mutation site11944/11955-12432/12433 (478 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(Z68108.1:28888..29047, 106..154, 438..576, 679..1047, 1702..1788, 1907..2143, 2194..2290, 2544..2875, 2924..3196, 3570..3869, 3914..4066, 4114..4339, 4654..4759, 4804..5041, 5122..5232, 6422..6649, 9135..9255, 9692..9785, 9834..9973, 10132..10345, 10499..10764, 10993..11071, 11433..11601, 11651..11800, 11849..12031, 12155..12390, 12561..12686, 12731..13022, 13143..13352, 13413..13693, 15958..16033, )
Map position2.54
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGCAAATAGCCTGGAGAGT,IntFwd:GGCGGACCAGATTGTGACGA,IntRev:CACAATCTCGTGTGATTCCA,ExtRev:AACGAGCACTGAGAATGCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kunitomo H, Sato H, Iwata R, Satoh Y, Ohno H, Yamada K, Iino Y.
Concentration memory-dependent synaptic plasticity of a taste circuit regulates salt concentration chemotaxis in Caenorhabditis elegans.
Nat Commun 2013 4 2210 
[ PubMed ID = 23887678 ] [ RRC reference ]

Nagy AI, Vázquez-Manrique RP, Lopez M, Christov CP, Sequedo MD, Herzog M, Herlihy AE, Bodak M, Gatsi R, Baylis HA.
IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans.
EMBO Rep 2015 16(3) 341-50 
[ PubMed ID = 25608529 ] [ RRC reference ]

Kimata T, Tanizawa Y, Can Y, Ikeda S, Kuhara A, Mori I.
Synaptic polarity depends on phosphatidylinositol signaling regulated by myo-inositol monophosphatase in Caenorhabditis elegans.
Genetics 2012 191(2) 509-21 
[ PubMed ID = 22446320 ] [ RRC reference ]

Vázquez-Manrique RP, Nagy AI, Legg JC, Bales OA, Ly S, Baylis HA.
Phospholipase C-epsilon regulates epidermal morphogenesis in Caenorhabditis elegans.
PLoS Genet 2008 4(3) e1000043 
[ PubMed ID = 18369461 ] [ RRC reference ]