Mutants (Isolated)

tm748

Allele Nametm748
Sequence NameZK899.8
CGC Namegap-2
Worm BaseAllele Name tm748
CGC Name gap-2
Sequence ZK899.8
Phenotypehomozygous viable. Dr. A. Hajnal: Dev. Biol. 323, 166 (2008)
Mutation site[C07B5] 6561/6562-GCTTTAGAATC-[C07B5] 8030/8031 (1469 bp deletion + 11 bp insertion)
ChromosomeX
Putative gene structurejoin(31222..31372, Z37979:224..345, Z37979:1274..1343, Z37979:1926..2105, Z37979:21503..21723, Z37979:23073..23164, Z37979:27804..27976, Z37979:28874..28994, Z46266:3854..4054, Z46266:4357..4491, Z46266:6460..6685, Z46266:6749..7092, Z46266:7141..7479, Z46266:7633..7893, Z46266:8038..8412, Z46266:8466..8658, Z46266:8703..8872, Z46266:8918..9074, Z46266:9126..9218)
Map position1.32
Balancer
Map position of balancer
Sequence of primersIntRev:GCCATTCGTTCAACTGGAGA,IntFwd:CACCCCGACAGTATAAGTTA,ExtFwd:AGGTCGCCATCAAGGTTACA,ExtRev:GCAATTGATAGAGCGGCCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stetak A, Gutierrez P, Hajnal A.
Tissue-specific functions of the Caenorhabditis elegans p120 Ras GTPase activating protein GAP-3.
Dev. Biol. 2008 323(2) 166-76 
[ PubMed ID = 18805410 ] [ RRC reference ]

Clayton JE, van den Heuvel SJ, Saito RM.
Transcriptional control of cell-cycle quiescence during C. elegans development.
Dev. Biol. 2008 313(2) 603-13 
[ PubMed ID = 18082681 ] [ RRC reference ]

Yang Y, Han SM, Miller MA.
MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling.
Dev. Biol. 2010 342(1) 96-107 
[ PubMed ID = 20380830 ] [ RRC reference ]