| Allele Name | tm748 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | ZK899.8 |
| Gene Name | gap-2 |
| Worm Base | Allele Name |
tm748
|
| Gene Name |
gap-2
|
| Sequence |
ZK899.8
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. A. Hajnal: Dev. Biol. 323, 166 (2008) |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| [C07B5] 6561/6562-GCTTTAGAATC-[C07B5] 8030/8031 (1469 bp deletion + 11 bp insertion) |
| Chromosome | X |
| Putative gene structure | join(31221..31372, 224..345, 1274..1343, 1926..2105, 21502..21722, 23072..23163, 27802..27974, 28872..28992, 3854..4054, 4357..4491, 6460..6685, 6749..7092, 7141..7479, 7633..7893, 8038..8412, 8466..8658, 8703..8872, 8918..9074, 9126..9783) |
| Map position | 1.32 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GCCATTCGTTCAACTGGAGA,IntFwd:CACCCCGACAGTATAAGTTA,ExtFwd:AGGTCGCCATCAAGGTTACA,ExtRev:GCAATTGATAGAGCGGCCAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ohta A, Sato Y, Isono K, Kajino T, Tanaka K, Taji T, Kuhara A.
The intron binding protein EMB-4 is an opposite regulator of cold and high temperature tolerance in Caenorhabditis elegans.
PNAS Nexus 2024 3(8) pgae293
[ PubMed ID = 39118835 ]
[ RRC reference ]
|
Lee H, Boor SA, Hilbert ZA, Meisel JD, Park J, Wang Y, McKeown R, Fischer SEJ, Andersen EC, Kim DH.
Genetic variants that modify neuroendocrine gene expression and foraging behavior of C. elegans.
Sci Adv 2024 10(24) eadk9481
[ PubMed ID = 38865452 ]
[ RRC reference ]
|
Rawsthorne H, Calahorro F, Holden-Dye L, O' Connor V, Dillon J.
Investigating autism associated genes in C. elegans reveals candidates with a role in social behaviour.
PLoS One 2021 16(5) e0243121
[ PubMed ID = 34043629 ]
[ RRC reference ]
|
McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667
[ PubMed ID = 31754030 ]
[ RRC reference ]
|
Gyurkó MD, Csermely P, Sőti C, Steták A.
Distinct roles of the RasGAP family proteins in C. elegans associative learning and memory.
Sci Rep 2015 5 15084
[ PubMed ID = 26469632 ]
[ RRC reference ]
|
Yang Y, Han SM, Miller MA.
MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling.
Dev Biol 2010 342(1) 96-107
[ PubMed ID = 20380830 ]
[ RRC reference ]
|
Stetak A, Gutierrez P, Hajnal A.
Tissue-specific functions of the Caenorhabditis elegans p120 Ras GTPase activating protein GAP-3.
Dev Biol 2008 323(2) 166-76
[ PubMed ID = 18805410 ]
[ RRC reference ]
|
Clayton JE, van den Heuvel SJ, Saito RM.
Transcriptional control of cell-cycle quiescence during C. elegans development.
Dev Biol 2008 313(2) 603-13
[ PubMed ID = 18082681 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.