Mutants (Isolated)

tm748

Allele Nametm748
Sequence NameZK899.8
CGC Namegap-2
Worm BaseAllele Name tm748
CGC Name gap-2
Sequence ZK899.8
Phenotypehomozygous viable. Dr. A. Hajnal: Dev. Biol. 323, 166 (2008)
Mutation site[C07B5] 6561/6562-GCTTTAGAATC-[C07B5] 8030/8031 (1469 bp deletion + 11 bp insertion)
ChromosomeX
Putative gene structurejoin(31222..31372, Z37979:224..345, Z37979:1274..1343, Z37979:1926..2105, Z37979:21503..21723, Z37979:23073..23164, Z37979:27804..27976, Z37979:28874..28994, Z46266:3854..4054, Z46266:4357..4491, Z46266:6460..6685, Z46266:6749..7092, Z46266:7141..7479, Z46266:7633..7893, Z46266:8038..8412, Z46266:8466..8658, Z46266:8703..8872, Z46266:8918..9074, Z46266:9126..9218)
Map position1.32
Balancer
Map position of balancer
Sequence of primersIntRev:GCCATTCGTTCAACTGGAGA,IntFwd:CACCCCGACAGTATAAGTTA,ExtFwd:AGGTCGCCATCAAGGTTACA,ExtRev:GCAATTGATAGAGCGGCCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gyurkó MD, Csermely P, Sőti C, Steták A.
Distinct roles of the RasGAP family proteins in C. elegans associative learning and memory.
Sci Rep 2015 5 15084 
[ PubMed ID = 26469632 ] [ RRC reference ]

Yang Y, Han SM, Miller MA.
MSP hormonal control of the oocyte MAP kinase cascade and reactive oxygen species signaling.
Dev Biol 2010 342(1) 96-107 
[ PubMed ID = 20380830 ] [ RRC reference ]

Stetak A, Gutierrez P, Hajnal A.
Tissue-specific functions of the Caenorhabditis elegans p120 Ras GTPase activating protein GAP-3.
Dev Biol 2008 323(2) 166-76 
[ PubMed ID = 18805410 ] [ RRC reference ]

Clayton JE, van den Heuvel SJ, Saito RM.
Transcriptional control of cell-cycle quiescence during C. elegans development.
Dev Biol 2008 313(2) 603-13 
[ PubMed ID = 18082681 ] [ RRC reference ]

McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667 
[ PubMed ID = 31754030 ] [ RRC reference ]