Home > Mutants (Isolated) > tm742

Mutants (Isolated)

Allele Name		tm742
Allele Type		Normal
Sequence Name		F49E8.4
Gene Name		cdd-2
Worm Base	Allele Name	tm742
	Gene Name	cdd-2
	Sequence	F49E8.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. M. Han: Gro, slightly Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		4019/4020-TT-5194/5195 (1175 bp deletion + 2 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(4408..4581, 4627..4808, 4905..5049))
Map position		3.35
Balancer
Map position of balancer
Sequence of primers		IntRev:CGTTCGTGGTCGACAAACTA,ExtRev:TCGTTCGCGAACGAACGTTC,IntFwd:CTGCGATAAAATCCTCGCAT,ExtFwd:TCGGTGCCGTTCTTATCCTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Jia F, Chi C, Han M. Regulation of Nucleotide Metabolism and Germline Proliferation in Response to Nucleotide Imbalance and Genotoxic Stresses by EndoU Nuclease. Cell Rep 2020 30(6) 1848-1861.e5  [ PubMed ID = 32049015 ] [ RRC reference ] Chi C, Ronai D, Than MT, Walker CJ, Sewell AK, Han M. Nucleotide levels regulate germline proliferation through modulating GLP-1/Notch signaling in C. elegans. Genes Dev 2016 30(3) 307-20  [ PubMed ID = 26833730 ] [ RRC reference ]