分離済み変異体

tm738

Allele Nametm738
BalanceCompleted
OutCrossNot Accepted
Sequence NameF31B12.1
Gene Nameplc-1
Worm BaseAllele Name tm738 (x1)
Gene Name plc-1
Sequence F31B12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. V. Maricq: mostly sterile and has a defect in spermatheca dilation which leads to f failure in fertilization. Dr. H. Baylis: PLoS Genetics 4, e1000043 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11030/11031-11600/11601 (570 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(28188..28492, 28951..[F31B12]154, 438..576, 679..806, 861..1047, 1702..1788, 1907..2143, 2194..2290, 2544..2875, 2924..3196, 3570..3869, 3914..4066, 4114..4339, 4654..4759, 4804..5041, 5122..5232, 6422..6649, 9135..9255, 9692..9785, 9834..9973, 10132..10345, 10499..10764, 10993..11071, 11463..11601, 11651..11800, 11849..12031, 12155..12390, 12561..12686, 12731..13022, 13143..13352, 13413..13693, 15958..16071)
Map position2.54
Balancer,tmC24[tmIs1240 tm9719]
Map position of balancer
Sequence of primersExtFwd:CAGCAAATAGCCTGGAGAGT,IntFwd:GGCGGACCAGATTGTGACGA,IntRev:CACAATCTCGTGTGATTCCA,ExtRev:AACGAGCACTGAGAATGCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Vázquez-Manrique RP, Nagy AI, Legg JC, Bales OA, Ly S, Baylis HA.
Phospholipase C-epsilon regulates epidermal morphogenesis in Caenorhabditis elegans.
PLoS Genet 2008 4(3) e1000043 
[ PubMed ID = 18369461 ] [ RRC reference ]