分離済み変異体

tm734

Allele Nametm734
BalanceNot Required
OutCrossNot Accepted
Sequence NameF40H3.5
Gene Namehst-3.1
Worm BaseAllele Name tm734
Gene Name hst-3.1
Sequence F40H3.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Hobert: no axonal phenotypes in AFD, PVQ, HSN and DA/DB neurons.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 499/500-TTTT-947/948 (448 bp deletion + 4 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(85..104, 154..283, 328..546, 596..730, 784..964, 1382..1527))
Map position-0.41
Balancer
Map position of balancer
Sequence of primersExtRev:CTTGCACACGTTTTGACAGT,IntFwd:CTTCCACTTTCCGTAACTGA,ExtFwd:AAACCAATTGGCTCGGGGTA,IntRev:CCGGAAGTGTATTCTTGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cizeron M, Granger L, Bülow HE, Bessereau JL.
Specific heparan sulfate modifications stabilize the synaptic organizer MADD-4/Punctin at Caenorhabditis elegans neuromuscular junctions.
Genetics 2021 218(4)  
[ PubMed ID = 33983408 ] [ RRC reference ]

Acker N, Smith H, Devine C, Oltjen SL, Tsiropoulou S, Smit-McBride Z, Lange K, Blacque OE, Matsubara JA, Gordus A, Golden A, Vogel BE.
A complement factor H homolog, heparan sulfation, and syndecan maintain inversin compartment boundaries in C. elegans cilia.
Proc Natl Acad Sci U S A 2021 118(16)  
[ PubMed ID = 33859044 ] [ RRC reference ]

Lázaro-Peña MI, Díaz-Balzac CA, Bülow HE, Emmons SW.
Synaptogenesis Is Modulated by Heparan Sulfate in Caenorhabditis elegans.
Genetics 2018 209(1) 195-208 
[ PubMed ID = 29559501 ] [ RRC reference ]

Saied-Santiago K, Townley RA, Attonito JD, da Cunha DS, Díaz-Balzac CA, Tecle E, Bülow HE.
Coordination of Heparan Sulfate Proteoglycans with Wnt Signaling To Control Cellular Migrations and Positioning in Caenorhabditis elegans.
Genetics 2017 206(4) 1951-1967 
[ PubMed ID = 28576860 ] [ RRC reference ]

Edwards TJ, Hammarlund M.
Syndecan promotes axon regeneration by stabilizing growth cone migration.
Cell Rep 2014 8(1) 272-83 
[ PubMed ID = 25001284 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]

Tecle E, Diaz-Balzac CA, Bülow HE.
Distinct 3-O-sulfated heparan sulfate modification patterns are required for kal-1-dependent neurite branching in a context-dependent manner in Caenorhabditis elegans.
G3 (Bethesda) 2013 3(3) 541-52 
[ PubMed ID = 23451335 ] [ RRC reference ]

Gysi S, Rhiner C, Flibotte S, Moerman DG, Hengartner MO.
A network of HSPG core proteins and HS modifying enzymes regulates netrin-dependent guidance of D-type motor neurons in Caenorhabditis elegans.
PLoS One 2013 8(9) e74908 
[ PubMed ID = 24066155 ] [ RRC reference ]

Attreed M, Desbois M, van Kuppevelt TH, Bülow HE.
Direct visualization of specifically modified extracellular glycans in living animals.
Nat Methods 2012 9(5) 477-9 
[ PubMed ID = 22466794 ] [ RRC reference ]