Home > Mutants (Isolated) > tm734

Mutants (Isolated)

Allele Name		tm734
Allele Type		Normal
Sequence Name		F40H3.5
Gene Name		hst-3.1
Worm Base	Allele Name	tm734
	Gene Name	hst-3.1
	Sequence	F40H3.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. O. Hobert: no axonal phenotypes in AFD, PVQ, HSN and DA/DB neurons.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		499/500-TTTT-947/948 (448 bp deletion + 4 bp insertion)
Chromosome		II
Putative gene structure		complement(join(85..104, 154..283, 328..546, 596..730, 784..964, 1382..1527))
Map position		-0.41
Balancer
Map position of balancer
Sequence of primers		ExtRev:CTTGCACACGTTTTGACAGT,IntFwd:CTTCCACTTTCCGTAACTGA,ExtFwd:AAACCAATTGGCTCGGGGTA,IntRev:CCGGAAGTGTATTCTTGGCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Cizeron M, Granger L, Bülow HE, Bessereau JL. Specific heparan sulfate modifications stabilize the synaptic organizer MADD-4/Punctin at Caenorhabditis elegans neuromuscular junctions. Genetics 2021 218(4)   [ PubMed ID = 33983408 ] [ RRC reference ] Acker N, Smith H, Devine C, Oltjen SL, Tsiropoulou S, Smit-McBride Z, Lange K, Blacque OE, Matsubara JA, Gordus A, Golden A, Vogel BE. A complement factor H homolog, heparan sulfation, and syndecan maintain inversin compartment boundaries in C. elegans cilia. Proc Natl Acad Sci U S A 2021 118(16)   [ PubMed ID = 33859044 ] [ RRC reference ] Lázaro-Peña MI, Díaz-Balzac CA, Bülow HE, Emmons SW. Synaptogenesis Is Modulated by Heparan Sulfate in Caenorhabditis elegans. Genetics 2018 209(1) 195-208  [ PubMed ID = 29559501 ] [ RRC reference ] Saied-Santiago K, Townley RA, Attonito JD, da Cunha DS, Díaz-Balzac CA, Tecle E, Bülow HE. Coordination of Heparan Sulfate Proteoglycans with Wnt Signaling To Control Cellular Migrations and Positioning in Caenorhabditis elegans. Genetics 2017 206(4) 1951-1967  [ PubMed ID = 28576860 ] [ RRC reference ] Tecle E, Diaz-Balzac CA, Bülow HE. Distinct 3-O-sulfated heparan sulfate modification patterns are required for kal-1-dependent neurite branching in a context-dependent manner in Caenorhabditis elegans. G3 (Bethesda) 2013 3(3) 541-52  [ PubMed ID = 23451335 ] [ RRC reference ] Attreed M, Desbois M, van Kuppevelt TH, Bülow HE. Direct visualization of specifically modified extracellular glycans in living animals. Nat Methods 2012 9(5) 477-9  [ PubMed ID = 22466794 ] [ RRC reference ] Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M. Axon regeneration genes identified by RNAi screening in C. elegans. J Neurosci 2014 34(2) 629-45  [ PubMed ID = 24403161 ] [ RRC reference ] Gysi S, Rhiner C, Flibotte S, Moerman DG, Hengartner MO. A network of HSPG core proteins and HS modifying enzymes regulates netrin-dependent guidance of D-type motor neurons in Caenorhabditis elegans. PLoS One 2013 8(9) e74908  [ PubMed ID = 24066155 ] [ RRC reference ] Edwards TJ, Hammarlund M. Syndecan promotes axon regeneration by stabilizing growth cone migration. Cell Rep 2014 8(1) 272-83  [ PubMed ID = 25001284 ] [ RRC reference ]