Mutants (Isolated)

tm7132

Allele Nametm7132
BalanceCompleted
OutCrossNot Accepted
Sequence NameB0222.9
Gene Namegad-3
Worm BaseAllele Name tm7132 (x1)
Gene Name gad-3
Sequence B0222.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Gro
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 39081/39082-39707/39708 (626 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(35900..36428, 36484..36716, 36763..37384, 37450..37619, 37665..37755, 37802..37986, 38150..38346, 38391..38490, 38535..38846, 38896..39096, 39148..39248, 39294..39416, 39463..39598, 39643..39962, 40073..40306, 40358..40457))
Map position1.95
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:CCAACCGATTCGACCTATCA,IntFwd:CGTAGTTAGTGGACGTATAC,ExtRev:ATGGCTAGAGGACATGCGTT,IntRev:GGACATGCGTTGCAGTGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]