| Allele Name | tm710 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | K01G5.6 |
| Gene Name | rib-2 |
| Worm Base | Allele Name |
tm710
(x1) |
| Gene Name |
rib-2
|
| Sequence |
K01G5.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. P. Okkema: maternal effect lehtal, late embryonic, early larval arrest. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 2128/2129-3434/3435 (1306 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(2325..2343, 2395..2530, 2576..2653, 2710..2810, 2856..2988, 3044..3224, 3714..5171, 5586..5737, 5790..5976) |
| Map position | 5.11 |
| Balancer | unc-119 (ed3) III |
| Map position of balancer | |
| Sequence of primers | IntFwd:CATTTGCCGCGGAATTGGTT,IntRev:CGAGTAAATGTCGATCCGCT,ExtFwd:TTGGGACGAGAATGACTCAT,ExtRev:GGCTAGCAAACTCCTCGCGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Blanchette CR, Thackeray A, Perrat PN, Hekimi S, Bénard CY. Functional Requirements for Heparan Sulfate Biosynthesis in Morphogenesis and Nervous System Development in C. elegans. PLoS Genet 2017 13(1) e1006525
[ PubMed ID = 28068429 ]
[ RRC reference ]
|
Dejima K, Kang S, Mitani S, Cosman PC, Chisholm AD. Syndecan defines precise spindle orientation by modulating Wnt signaling in C. elegans. Development 2014 141(22) 4354-65
[ PubMed ID = 25344071 ]
[ RRC reference ]
|
Kitagawa H, Izumikawa T, Mizuguchi S, Dejima K, Nomura KH, Egusa N, Taniguchi F, Tamura J, Gengyo-Ando K, Mitani S, Nomura K, Sugahara K. Expression of rib-1, a Caenorhabditis elegans homolog of the human tumor suppressor EXT genes, is indispensable for heparan sulfate synthesis and embryonic morphogenesis. J Biol Chem 2007 282(11) 8533-44
[ PubMed ID = 17237233 ]
[ RRC reference ]
|
|