Mutants (Isolated)

tm710

Allele Nametm710
Sequence NameK01G5.6
CGC Namerib-2
Worm BaseAllele Name tm710
CGC Name rib-2
Sequence K01G5.6
Phenotypelethal or sterile. Dr. P. Okkema: maternal effect lehtal, late embryonic, early larval arrest.
Mutation site2128/2129-3434/3435 (1306 bp deletion)
ChromosomeIII
Putative gene structurejoin(2325..2343, 2395..2530, 2576..2653, 2710..2810, 2856..2988, 3044..3224, 3714..5171, 5586..5737, 5790..5976)
Map position5.11
Balancerunc-119 (ed3) III
Map position of balancer5.59
Sequence of primersIntRev:CGAGTAAATGTCGATCCGCT,IntFwd:CATTTGCCGCGGAATTGGTT,ExtRev:GGCTAGCAAACTCCTCGCGA,ExtFwd:TTGGGACGAGAATGACTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication