分離済み変異体

tm698

Allele Nametm698
BalanceNot Required
OutCrossNot Accepted
Sequence NameT22H2.5a
Gene Namescrm-1
Worm BaseAllele Name tm698
Gene Name scrm-1
Sequence T22H2.5a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 165/166-1027/1028 (862 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(772..776, 1008..1053, 1101..1159, 1206..1308, 1715..2017, 2118..2192))
Map position9.53
Balancer
Map position of balancer
Sequence of primersExtRev:TCACGTCACGTGAATCACTA,IntRev:CCAGATTGTAGCGCTGAATT,ExtFwd:GGTCTTGCAGTTCAACGTAA,IntFwd:AACCGGTGGAGCAGGGTTAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Mitani S.
Comprehensive functional genomics using Caenorhabditis elegans as a model organism.
Proc Jpn Acad Ser B Phys Biol Sci 2017 93(8) 561-577 
[ PubMed ID = 29021508 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Hsu TY, Wu YC.
Engulfment of apoptotic cells in C. elegans is mediated by integrin alpha/SRC signaling.
Curr Biol 2010 20(6) 477-86 
[ PubMed ID = 20226672 ] [ RRC reference ]

Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat Cell Biol 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]