Mutants (Isolated)

tm698

Allele Nametm698
Sequence NameT22H2.5a
CGC Namescrm-1
Worm BaseAllele Name tm698
CGC Name scrm-1
Sequence T22H2.5a
Phenotypehomozygous viable
Mutation site165/166-1027/1028 (862 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(772..776, 1008..1053, 1101..1159, 1206..1308, 1715..2017, 2118..2192))
Map position9.53
Balancer
Map position of balancer
Sequence of primersExtRev:TCACGTCACGTGAATCACTA,IntRev:CCAGATTGTAGCGCTGAATT,ExtFwd:GGTCTTGCAGTTCAACGTAA,IntFwd:AACCGGTGGAGCAGGGTTAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Mitani S.
Comprehensive functional genomics using Caenorhabditis elegans as a model organism.
Proc. Jpn. Acad., Ser. B, Phys. Biol. Sci. 2017 93(8) 561-577 
[ PubMed ID = 29021508 ] [ RRC reference ]

Hsu TY, Wu YC.
Engulfment of apoptotic cells in C. elegans is mediated by integrin alpha/SRC signaling.
Curr. Biol. 2010 20(6) 477-86 
[ PubMed ID = 20226672 ] [ RRC reference ]

Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat. Cell Biol. 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]