Mutants (Isolated)

tm6882

Allele Nametm6882
BalanceNot Required
OutCrossNot Accepted
Sequence NameC02A12.1
Gene Namegst-33
Worm BaseAllele Name tm6882
Gene Name gst-33
Sequence C02A12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1288/1289-1559/1560 (271 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(865..1052, 1104..1497, 1762..1821))
Map position-11.5
Balancer
Map position of balancer
Sequence of primersExtFwd:ATATGGCTTGAGCTTCGGGT,IntFwd:GGTGCTCAGCGATACGCTTG,ExtRev:CTTCAACGCTCGCGGATATG,IntRev:GAGGCTTCGAGAGCTGTAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Earley BJ, Cubillas C, Warnhoff K, Ahmad R, Alcantar A, Lyon MD, Schneider DL, Kornfeld K.
Cadmium hijacks the high zinc response by binding and activating the HIZR-1 nuclear receptor.
Proc Natl Acad Sci U S A 2021 118(42)  
[ PubMed ID = 34649987 ] [ RRC reference ]