Mutants (Isolated)

tm6706

Allele Nametm6706
Sequence NameB0024.15
CGC NameB0024.15
Worm BaseAllele Name tm6706
CGC Name B0024.15
Sequence B0024.15
Phenotypehomozygous viable.
Mutation site4201/4202-4655/4656 (454 bp deletion)
ChromosomeV
Putative gene structurejoin(3737..3782, 3918..4113, 4169..4274, 4319..4653, 4695..4827, 4907..5119)
Map position2.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GACTATTGTACTCTGGAGTG,IntFwd:ACTCTGGAGTGTACAGACTG,ExtRev:GGATCTGATGCTGCCTATTG,IntRev:CGCTTGTCCAACTCGTTCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]