Mutants (Isolated)

tm6706

Allele Nametm6706
Allele TypeNormal
Sequence NameB0024.15
Gene NameB0024.15
Worm BaseAllele Name tm6706
Gene Name B0024.15
Sequence B0024.15
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4201/4202-4655/4656 (454 bp deletion)
ChromosomeV
Putative gene structurejoin(3737..3782, 3918..4113, 4169..4274, 4319..4653, 4695..4827, 4907..5119)
Map position2.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GACTATTGTACTCTGGAGTG,IntFwd:ACTCTGGAGTGTACAGACTG,ExtRev:GGATCTGATGCTGCCTATTG,IntRev:CGCTTGTCCAACTCGTTCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]