Mutants (Isolated)

tm668

Allele Nametm668
Sequence NameH15N14.1d
CGC Nameadr-1
Worm BaseAllele Name tm668
CGC Name adr-1
Sequence H15N14.1d
Phenotypehomozygous viable. Dr. H. Sawa: Pvul, Egl.
Mutation site3992/3993-4959/4960 (967 bp deletion)
ChromosomeI
Putative gene structurejoin(3232..3306, 3807..3875, 3927..4064, 4192..4389, 4437..4537, 4589..4835, 4887..4946, 4996..5527, 5577..5838, 5911..6180, 6228..6554, 6606..7125, 7183..7263)
Map position2.35
Balancer
Map position of balancer
Sequence of primersIntFwd:GCTGGCTACCCACACGGTAT,IntRev:GCATCTGTTTTCACACAGGA,ExtFwd:TACAACTGGGCAAGTCAATG,ExtRev:AGAGCACACGGTCCCTGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hundley HA, Krauchuk AA, Bass BL.
C. elegans and H. sapiens mRNAs with edited 3' UTRs are present on polysomes.
RNA 2008 14(10) 2050-60 
[ PubMed ID = 18719245 ] [ RRC reference ]

Reich DP, Tyc KM, Bass BL.
C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.
Genes Dev. 2018 32(3-4) 271-282 
[ PubMed ID = 29483152 ] [ RRC reference ]

Deffit SN, Yee BA, Manning AC, Rajendren S, Vadlamani P, Wheeler EC, Domissy A, Washburn MC, Yeo GW, Hundley HA.
The C. elegans neural editome reveals an ADAR target mRNA required for proper chemotaxis.
Elife 2017 6  
[ PubMed ID = 28925356 ] [ RRC reference ]

Wheeler EC, Washburn MC, Major F, Rusch DB, Hundley HA.
Noncoding regions of C. elegans mRNA undergo selective adenosine to inosine deamination and contain a small number of editing sites per transcript.
RNA Biol 2015 12(2) 162-74 
[ PubMed ID = 25826568 ] [ RRC reference ]

Washburn MC, Kakaradov B, Sundararaman B, Wheeler E, Hoon S, Yeo GW, Hundley HA.
The dsRBP and inactive editor ADR-1 utilizes dsRNA binding to regulate A-to-I RNA editing across the C. elegans transcriptome.
Cell Rep 2014 6(4) 599-607 
[ PubMed ID = 24508457 ] [ RRC reference ]

Warf MB, Shepherd BA, Johnson WE, Bass BL.
Effects of ADARs on small RNA processing pathways in C. elegans.
Genome Res. 2012 22(8) 1488-98 
[ PubMed ID = 22673872 ] [ RRC reference ]

Wu D, Lamm AT, Fire AZ.
Competition between ADAR and RNAi pathways for an extensive class of RNA targets.
Nat. Struct. Mol. Biol. 2011 18(10) 1094-101 
[ PubMed ID = 21909095 ] [ RRC reference ]

Goldstein B, Agranat-Tamir L, Light D, Ben-Naim Zgayer O, Fishman A, Lamm AT.
A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.
Genome Res. 2017 27(3) 462-470 
[ PubMed ID = 28031250 ] [ RRC reference ]