| Allele Name | tm650 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | ZK1053.5 |
| Gene Name | scrm-2 |
| Worm Base | Allele Name |
tm650
|
| Gene Name |
scrm-2
|
| Sequence |
ZK1053.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 7425/7426-7832/7833 (407bp deletion) |
| Chromosome | I |
| Putative gene structure | join(7667..8029, 8194..8436, 8480..8582, 8627..8685, 8741..8770) |
| Map position | 17.25 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:ATGTGCATGGCAGTAGAGCA,IntRev:GCATGTCGGTGGTAACGATA,IntFwd:TCGCTGGTCCCACTTTCTGA,ExtFwd:ACTTTCCGAACACATTCGCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat Cell Biol 2007 9(5) 541-9
[ PubMed ID = 17401362 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.