Mutants (Isolated)

tm650

Allele Nametm650
Sequence NameZK1053.5
CGC Namescrm-2
Worm BaseAllele Name tm650
CGC Name scrm-2
Sequence ZK1053.5
Phenotypehomozygous viable
Mutation site7425/7426-7832/7833 (407bp deletion)
ChromosomeI
Putative gene structurejoin(7667..8029, 8194..8436, 8480..8582, 8627..8685, 8741..8770)
Map position17.25
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGCTGGTCCCACTTTCTGA,IntRev:GCATGTCGGTGGTAACGATA,ExtRev:ATGTGCATGGCAGTAGAGCA,ExtFwd:ACTTTCCGAACACATTCGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat. Cell Biol. 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]