Mutants (Isolated)

tm6424

Allele Nametm6424
Sequence NameC27H6.3
CGC NameC27H6.3
Worm BaseAllele Name tm6424
CGC Name C27H6.3
Sequence C27H6.3
Phenotypehomozygous viable.
Mutation site19374/19375-20053/20054 (679 bp deletion)
ChromosomeV
Putative gene structurejoin(19064..19099, 19147..19351, 19404..19728, 19783..20332, 20531..20899, 20956..21113, 21166..21322, 21366..21548)
Map position2.23
Balancer
Map position of balancer
Sequence of primersIntFwd:GCATTCCATTCGGGAACCTG,ExtRev:CGATAGACTTGATTACGGAG,ExtFwd:TCGGGTCTCAATGGAAGGGA,IntRev:GGAGGTGCAAACTCGGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Goh WS, Seah JW, Harrison EJ, Chen C, Hammell CM, Hannon GJ.
A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis.
Genes Dev. 2014 28(7) 797-807 
[ PubMed ID = 24696458 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]