分離済み変異体

tm6424

Allele Nametm6424
BalanceNot Required
OutCrossNot Accepted
Sequence NameC27H6.3
Gene NameC27H6.3
Worm BaseAllele Name tm6424
Gene Name C27H6.3
Sequence C27H6.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19374/19375-20053/20054 (679 bp deletion)
ChromosomeV
Putative gene structurejoin(19064..19099, 19147..19351, 19404..19728, 19783..20332, 20531..20899, 20956..21113, 21166..21322, 21366..21548)
Map position2.23
Balancer
Map position of balancer
Sequence of primersIntFwd:GCATTCCATTCGGGAACCTG,ExtRev:CGATAGACTTGATTACGGAG,ExtFwd:TCGGGTCTCAATGGAAGGGA,IntRev:GGAGGTGCAAACTCGGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang X, Wang C, Zhang T, Li R, Chen L, Leung KL, Lakso M, Zhou Q, Zhang H, Wong G.
PIWI-interacting RNA expression regulates pathogenesis in a Caenorhabditis elegans model of Lewy body disease.
Nat Commun 2023 14(1) 6137 
[ PubMed ID = 37783675 ] [ RRC reference ]

Zeng C, Weng C, Wang X, Yan YH, Li WJ, Xu D, Hong M, Liao S, Dong MQ, Feng X, Xu C, Guang S.
Functional Proteomics Identifies a PICS Complex Required for piRNA Maturation and Chromosome Segregation.
Cell Rep 2019 27(12) 3561-3572.e3 
[ PubMed ID = 31216475 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Goh WS, Seah JW, Harrison EJ, Chen C, Hammell CM, Hannon GJ.
A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis.
Genes Dev 2014 28(7) 797-807 
[ PubMed ID = 24696458 ] [ RRC reference ]