Home > Mutants (Isolated) > tm6415

Mutants (Isolated)

Allele Name		tm6415
Allele Type		Normal
Sequence Name		F08A8.4
Gene Name		F08A8.4
Worm Base	Allele Name	tm6415
	Gene Name	F08A8.4
	Sequence	F08A8.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		19100/19101-19443/19444 (343 bp deletion)
Chromosome		I
Putative gene structure		join(18084..18197, 18252..18442, 18500..18660, 18751..19264, 19318..19582, 19629..19961, 20420..20695, 20738..20872)
Map position		15.42
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GGCGAGAGACTTCATATCTA,IntFwd:AGAGGTTACGGGGATGGAAG,ExtRev:GTTGCCTTCCAAGCTTGCCT,IntRev:CTTGCCTTCTAGCCATATGC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV. The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction. bioRxiv 2023    [ PubMed ID = 38045350 ] [ RRC reference ] Wang Y, Li C, Zhang J, Xu X, Fu L, Xu J, Zhu H, Hu Y, Li C, Wang M, Wu Y, Zou X, Liang B. Polyunsaturated fatty acids promote the rapid fusion of lipid droplets in Caenorhabditis elegans. J Biol Chem 2022 298(8) 102179  [ PubMed ID = 35752365 ] [ RRC reference ] Radeke LJ, Herman MA. Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia. BMC Microbiol 2020 20(1) 170  [ PubMed ID = 32560629 ] [ RRC reference ] Zhou Y, Wang Y, Zhang X, Bhar S, Jones Lipinski RA, Han J, Feng L, Butcher RA. Biosynthetic tailoring of existing ascaroside pheromones alters their biological function in C. elegans. Elife 2018 7   [ PubMed ID = 29863473 ] [ RRC reference ]