Mutants (Isolated)

tm6415

Allele Nametm6415
Sequence NameF08A8.4
CGC NameF08A8.4
Worm BaseAllele Name tm6415
CGC Name F08A8.4
Sequence F08A8.4
Phenotypehomozygous viable
Mutation site19100/19101-19443/19444 (343 bp deletion)
ChromosomeI
Putative gene structurejoin(18084..18197, 18252..18442, 18500..18660, 18751..19264, 19318..19582, 19629..19961, 20420..20695, 20738..20872)
Map position15.42
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCGAGAGACTTCATATCTA,IntFwd:AGAGGTTACGGGGATGGAAG,ExtRev:GTTGCCTTCCAAGCTTGCCT,IntRev:CTTGCCTTCTAGCCATATGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhou Y, Wang Y, Zhang X, Bhar S, Jones Lipinski RA, Han J, Feng L, Butcher RA.
Biosynthetic tailoring of existing ascaroside pheromones alters their biological function in C. elegans.
Elife 2018 7  
[ PubMed ID = 29863473 ] [ RRC reference ]