分離済み変異体

tm6415

Allele Nametm6415
BalanceNot Required
OutCrossNot Accepted
Sequence NameF08A8.4
Gene NameF08A8.4
Worm BaseAllele Name tm6415
Gene Name F08A8.4
Sequence F08A8.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19100/19101-19443/19444 (343 bp deletion)
ChromosomeI
Putative gene structurejoin(18084..18197, 18252..18442, 18500..18660, 18751..19264, 19318..19582, 19629..19961, 20420..20695, 20738..20872)
Map position15.42
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCGAGAGACTTCATATCTA,IntFwd:AGAGGTTACGGGGATGGAAG,ExtRev:GTTGCCTTCCAAGCTTGCCT,IntRev:CTTGCCTTCTAGCCATATGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Wang Y, Li C, Zhang J, Xu X, Fu L, Xu J, Zhu H, Hu Y, Li C, Wang M, Wu Y, Zou X, Liang B.
Polyunsaturated fatty acids promote the rapid fusion of lipid droplets in Caenorhabditis elegans.
J Biol Chem 2022 298(8) 102179 
[ PubMed ID = 35752365 ] [ RRC reference ]

Radeke LJ, Herman MA.
Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia.
BMC Microbiol 2020 20(1) 170 
[ PubMed ID = 32560629 ] [ RRC reference ]

Zhou Y, Wang Y, Zhang X, Bhar S, Jones Lipinski RA, Han J, Feng L, Butcher RA.
Biosynthetic tailoring of existing ascaroside pheromones alters their biological function in C. elegans.
Elife 2018 7  
[ PubMed ID = 29863473 ] [ RRC reference ]