Mutants (Isolated)

tm6374

Allele Nametm6374
Allele TypeNormal
Sequence NameC55F2.1
Gene Nameatic-1
Worm BaseAllele Name tm6374
Gene Name atic-1
Sequence C55F2.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12664/12665-AAACTAAACATTTTCT-13127/13128 (463 bp deletion + 16 bp insertion)
ChromosomeIV
Putative gene structurejoin(10840..10852, 11110..11235, 11808..11921, 12100..12150, 12402..12483, 12529..12622, 12666..12989, 13190..13263, 16868..16979, 17112..17168, 17356..17451, 18118..18237)
Map position3.5
Balancer
Map position of balancer
Sequence of primersIntFwd:TATGAGACGGCCGTGGTCTG,ExtFwd:TCATGCCGCTACCACTATGT,IntRev:GACCTGCTCCCATTCCAATG,ExtRev:GTCTCCAGCAAGTCTCGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Marsac R, Pinson B, Saint-Marc C, Olmedo M, Artal-Sanz M, Daignan-Fornier B, Gomes JE.
Purine Homeostasis Is Necessary for Developmental Timing, Germline Maintenance and Muscle Integrity in Caenorhabditis elegans.
Genetics 2019 211(4) 1297-1313 
[ PubMed ID = 30700528 ] [ RRC reference ]