Mutants (Isolated)

tm6310

Allele Nametm6310
BalanceCompleted
OutCrossNot Accepted
Sequence NameZK637.8
Gene Nameunc-32
Worm BaseAllele Name tm6310 (x1)
Gene Name unc-32
Sequence ZK637.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" Let or Set.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 23492/23493-TTGTTGTTA-24518/24519 (1026 bp deletion + 9 bp insertion)
ChromosomeIII
Putative gene structurejoin(21664..21816, 21898..22074, 22182..22310, 22560..22714, 23629..23838, 23893..25147, 26117..26257, 26370..26589, 26754..26925, 27145..27250)
Map position0
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersIntRev:AGCTTACCTGTCCAGGATAC,ExtFwd:CGATGCAATGTCGCCACTCA,IntFwd:CGGTAGGATCAGGCTTATTT,ExtRev:CACCTGAAAGACATGGGGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zapata RC, Carretero M, Reis FCG, Chaudry BS, Ofrecio J, Zhang D, Sasik R, Ciaraldi T, Petrascheck M, Osborn O.
Adipocytes control food intake and weight regain via Vacuolar-type H+ ATPase.
Nat Commun 2022 13(1) 5092 
[ PubMed ID = 36042358 ] [ RRC reference ]