Mutants (Isolated)

tm625

Allele Nametm625
Sequence NameT03F7.1
CGC Namesnf-11
Worm BaseAllele Name tm625
CGC Name snf-11
Sequence T03F7.1
Phenotypehomozygous viable. Dr. J. Rand: Mol. Biol. Cell 17, 3021 (2006)
Mutation site13063/13064-13592/13593 (529 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(11617..11715, 12019..12772, 12974..13345, 13392..13731, 14026..14157, 14568..14709, 15266..15325))
Map position3.07
Balancer
Map position of balancer
Sequence of primersIntRev:GATGCTCATAGATACCCTGT,IntFwd:CCCATACCGGGTAGTCATAA,ExtFwd:ATCCGAAGATATGTCCCCAT,ExtRev:CCGTGTCATGTCCCGTCTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mullen GP, Mathews EA, Saxena P, Fields SD, McManus JR, Moulder G, Barstead RJ, Quick MW, Rand JB.
The Caenorhabditis elegans snf-11 gene encodes a sodium-dependent GABA transporter required for clearance of synaptic GABA.
Mol. Biol. Cell 2006 17(7) 3021-30 
[ PubMed ID = 16641366 ] [ RRC reference ]