Mutants (Isolated)

tm624

Allele Nametm624
Sequence NameF11A6.2
CGC Namescrm-4
Worm BaseAllele Name tm624
CGC Name scrm-4
Sequence F11A6.2
PhenotypeHomozygous viable. Dr. D. Xue: Nature Cell Biol. 9, 514 (2007)
Mutation site28235/28236-28935/28936 (700 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(27280..27461, 27505..27604, 27796..28044, 28260..28535))
Map position9.53
Balancer
Map position of balancer
Sequence of primersExtFwd:ACCGATCGTGGATTCGTCGA,IntFwd:GACATCGTGGATTTGTTGGA,ExtRev:TAAATGCTCACAGAGCCCTA,IntRev:CCTACATCAAAACTGTGGGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat. Cell Biol. 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]