Home > Mutants (Isolated) > tm624

Mutants (Isolated)

Allele Name		tm624
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F11A6.2
Gene Name		scrm-4
Worm Base	Allele Name	tm624
	Gene Name	scrm-4
	Sequence	F11A6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Homozygous viable. Dr. D. Xue: Nature Cell Biol. 9, 514 (2007)
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		28235/28236-28935/28936 (700 bp deletion)
Chromosome		I
Putative gene structure		complement(join(27280..27461, 27505..27604, 27796..28044, 28260..28535))
Map position		9.53
Balancer
Map position of balancer
Sequence of primers		ExtFwd:ACCGATCGTGGATTCGTCGA,IntFwd:GACATCGTGGATTTGTTGGA,ExtRev:TAAATGCTCACAGAGCCCTA,IntRev:CCTACATCAAAACTGTGGGA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF. fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans. Elife 2025 13   [ PubMed ID = 39951337 ] [ RRC reference ] Ohta A, Sato Y, Isono K, Kajino T, Tanaka K, Taji T, Kuhara A. The intron binding protein EMB-4 is an opposite regulator of cold and high temperature tolerance in Caenorhabditis elegans. PNAS Nexus 2024 3(8) pgae293  [ PubMed ID = 39118835 ] [ RRC reference ] Murari E, Meadows D, Cuda N, Mangone M. A comprehensive analysis of 3'UTRs in Caenorhabditis elegans. Nucleic Acids Res 2024 52(13) 7523-7538  [ PubMed ID = 38917330 ] [ RRC reference ] Weng Y, Murphy CT. Male-specific behavioral and transcriptomic changes in aging C. elegans neurons. iScience 2024 27(6) 109910  [ PubMed ID = 38783998 ] [ RRC reference ] Chaturbedi A, Lee SS. Different gametogenesis states uniquely impact longevity in Caenorhabditis elegans. bioRxiv 2023    [ PubMed ID = 37398385 ] [ RRC reference ] Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D. C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1. Nat Cell Biol 2007 9(5) 541-9  [ PubMed ID = 17401362 ] [ RRC reference ]