Mutants (Isolated)

tm6196

Allele Nametm6196
Sequence NameY46G5A.31
CGC Namegsy-1
Worm BaseAllele Name tm6196
CGC Name gsy-1
Sequence Y46G5A.31
Phenotypehomozygous viable.
Mutation site193891/193892-194079/194080 (188 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(186134..186272, 187645..188023, 189688..189841, 190977..191558, 193219..193633, 195811..195992, 196644..196766, 197333..197377))
Map position12.08
Balancer
Map position of balancer
Sequence of primersExtFwd:TAACCTTTCTCTTCCCCGCT,IntFwd:TCTCTTCCCCGCTTCCGCAT,ExtRev:GCAAGTTAAATGACCGCTGA,IntRev:GCCCTGGCCTAGAAACCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Seo Y, Kingsley S, Walker G, Mondoux MA, Tissenbaum HA.
Metabolic shift from glycogen to trehalose promotes lifespan and healthspan in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2018 115(12) E2791-E2800 
[ PubMed ID = 29511104 ] [ RRC reference ]