Home > 分離済み変異体 > tm611

分離済み変異体

Allele Name		tm611
Allele Type		通常株
Sequence Name		T07G12.12
Gene Name		him-8
Worm Base	Allele Name	tm611
	Gene Name	him-8
	Sequence	T07G12.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. A. Dernburg: homozyous viable, Him., Cell 123, 1051-1063 (2005).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		34935/34936-35348/35349 (413 bp deletion)
Chromosome		IV
Putative gene structure		join(33482..33574, 33634..33965, 34417..34729, 34779..34972, 35021..35073, 35200..35258)
Map position		4.64
Balancer
Map position of balancer
Sequence of primers		ExtFwd:ACAGAATGAATTCGCCGGTG,IntRev:CGATGAGGAATCTGTGAGAA,IntFwd:TTCGCCGGTGGCAGCTCATT,ExtRev:ACGCTTTAGGCGCCGAATTT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K. A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J 2023 42(11) e105002  [ PubMed ID = 37078421 ] [ RRC reference ] Almanzar DE, Hamrick A, Rog O. Single-sister labeling in the C. elegans germline using the nucleotide analog EdU. STAR Protoc 2022 3(2) 101344  [ PubMed ID = 35509971 ] [ RRC reference ] Gordon SG, Kursel LE, Xu K, Rog O. Synaptonemal Complex dimerization regulates chromosome alignment and crossover patterning in meiosis. PLoS Genet 2021 17(3) e1009205  [ PubMed ID = 33730019 ] [ RRC reference ] Uebel CJ, Agbede D, Wallis DC, Phillips CM. Mutator Foci Are Regulated by Developmental Stage, RNA, and the Germline Cell Cycle in Caenorhabditis elegans. G3 (Bethesda) 2020 10(10) 3719-3728  [ PubMed ID = 32763952 ] [ RRC reference ] Farboud B, Novak CS, Nicoll M, Quiogue A, Meyer BJ. Dose-dependent action of the RNA binding protein FOX-1 to relay X-chromosome number and determine C. elegans sex. Elife 2020 9   [ PubMed ID = 33372658 ] [ RRC reference ] Rohožková J, Hůlková L, Fukalová J, Flachs P, Hozák P. Pairing of homologous chromosomes in C. elegans meiosis requires DEB-1 - an orthologue of mammalian vinculin. Nucleus 2019 10(1) 93-115  [ PubMed ID = 31068058 ] [ RRC reference ] Tajima T, Ogawa F, Nakamura S, Hashimoto M, Omote M, Nishimura H. Proteinase K is an activator for the male-dependent spermiogenesis pathway in Caenorhabditis elegans: Its application to pharmacological dissection of spermiogenesis. Genes Cells 2019 24(3) 244-258  [ PubMed ID = 30656805 ] [ RRC reference ] Janisiw E, Dello Stritto MR, Jantsch V, Silva N. BRCA1-BARD1 associate with the synaptonemal complex and pro-crossover factors and influence RAD-51 dynamics during Caenorhabditis elegans meiosis. PLoS Genet 2018 14(11) e1007653  [ PubMed ID = 30383754 ] [ RRC reference ] Ellenbecker M, Osterli E, Wang X, Day NJ, Baumgarten E, Hickey B, Voronina E. Dynein Light Chain DLC-1 Facilitates the Function of the Germline Cell Fate Regulator GLD-1 in Caenorhabditis elegans. Genetics 2019 211(2) 665-681  [ PubMed ID = 30509955 ] [ RRC reference ] Day NJ, Ellenbecker M, Voronina E. Caenorhabditis elegans DLC-1 associates with ribonucleoprotein complexes to promote mRNA regulation. FEBS Lett 2018 592(22) 3683-3695  [ PubMed ID = 30264890 ] [ RRC reference ] Link J, Paouneskou D, Velkova M, Daryabeigi A, Laos T, Labella S, Barroso C, Pacheco Piñol S, Montoya A, Kramer H, Woglar A, Baudrimont A, Markert SM, Stigloher C, Martinez-Perez E, Dammermann A, Alsheimer M, Zetka M, Jantsch V. Transient and Partial Nuclear Lamina Disruption Promotes Chromosome Movement in Early Meiotic Prophase. Dev Cell 2018 45(2) 212-225.e7  [ PubMed ID = 29689196 ] [ RRC reference ] Rog O, Köhler S, Dernburg AF. The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors. Elife 2017 6   [ PubMed ID = 28045371 ] [ RRC reference ] Bessler JB, Andersen EC, Villeneuve AM. Differential localization and independent acquisition of the H3K9me2 and H3K9me3 chromatin modifications in the Caenorhabditis elegans adult germ line. PLoS Genet 2010 6(1) e1000830  [ PubMed ID = 20107519 ] [ RRC reference ] Wagner CR, Kuervers L, Baillie DL, Yanowitz JL. xnd-1 regulates the global recombination landscape in Caenorhabditis elegans. Nature 2010 467(7317) 839-43  [ PubMed ID = 20944745 ] [ RRC reference ] Wynne DJ, Rog O, Carlton PM, Dernburg AF. Dynein-dependent processive chromosome motions promote homologous pairing in C. elegans meiosis. J Cell Biol 2012 196(1) 47-64  [ PubMed ID = 22232701 ] [ RRC reference ] Kim S, Govindan JA, Tu ZJ, Greenstein D. SACY-1 DEAD-Box helicase links the somatic control of oocyte meiotic maturation to the sperm-to-oocyte switch and gamete maintenance in Caenorhabditis elegans. Genetics 2012 192(3) 905-28  [ PubMed ID = 22887816 ] [ RRC reference ] Kim Y, Kostow N, Dernburg AF. The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans. Dev Cell 2015 35(2) 247-61  [ PubMed ID = 26506311 ] [ RRC reference ] Harper NC, Rillo R, Jover-Gil S, Assaf ZJ, Bhalla N, Dernburg AF. Pairing centers recruit a Polo-like kinase to orchestrate meiotic chromosome dynamics in C. elegans. Dev Cell 2011 21(5) 934-47  [ PubMed ID = 22018922 ] [ RRC reference ] Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF. Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint. PLoS Genet 2013 9(8) e1003679  [ PubMed ID = 23990794 ] [ RRC reference ] Phillips CM, Meng X, Zhang L, Chretien JH, Urnov FD, Dernburg AF. Identification of chromosome sequence motifs that mediate meiotic pairing and synapsis in C. elegans. Nat Cell Biol 2009 11(8) 934-42  [ PubMed ID = 19620970 ] [ RRC reference ]