Mutants (Isolated)

tm611

Allele Nametm611
Sequence NameT07G12.12
CGC Namehim-8
Worm BaseAllele Name tm611
CGC Name him-8
Sequence T07G12.12
Phenotypehomozygous viable. Dr. A. Dernburg: homozyous viable, Him., Cell 123, 1051-1063 (2005).
Mutation site34935/34936-35348/35349 (413 bp deletion)
ChromosomeIV
Putative gene structurejoin(33482..33574, 33634..33965, 34417..34729, 34779..34972, 35021..35073, 35200..35258)
Map position4.64
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:ACAGAATGAATTCGCCGGTG,IntRev:CGATGAGGAATCTGTGAGAA,IntFwd:TTCGCCGGTGGCAGCTCATT,ExtRev:ACGCTTTAGGCGCCGAATTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Phillips CM, Wong C, Bhalla N, Carlton PM, Weiser P, Meneely PM, Dernburg AF.
HIM-8 binds to the X chromosome pairing center and mediates chromosome-specific meiotic synapsis.
Cell 2005 123(6) 1051-63 
[ PubMed ID = 16360035 ] [ RRC reference ]

Nelms BL, Hanna-Rose W.
C. elegans HIM-8 functions outside of meiosis to antagonize EGL-13 Sox protein function.
Dev. Biol. 2006 293(2) 392-402 
[ PubMed ID = 16546157 ] [ RRC reference ]

Wynne DJ, Rog O, Carlton PM, Dernburg AF.
Dynein-dependent processive chromosome motions promote homologous pairing in C. elegans meiosis.
J. Cell Biol. 2012 196(1) 47-64 
[ PubMed ID = 22232701 ] [ RRC reference ]

Harper NC, Rillo R, Jover-Gil S, Assaf ZJ, Bhalla N, Dernburg AF.
Pairing centers recruit a Polo-like kinase to orchestrate meiotic chromosome dynamics in C. elegans.
Dev. Cell 2011 21(5) 934-47 
[ PubMed ID = 22018922 ] [ RRC reference ]

Bessler JB, Andersen EC, Villeneuve AM.
Differential localization and independent acquisition of the H3K9me2 and H3K9me3 chromatin modifications in the Caenorhabditis elegans adult germ line.
PLoS Genet. 2010 6(1) e1000830 
[ PubMed ID = 20107519 ] [ RRC reference ]

Phillips CM, Meng X, Zhang L, Chretien JH, Urnov FD, Dernburg AF.
Identification of chromosome sequence motifs that mediate meiotic pairing and synapsis in C. elegans.
Nat. Cell Biol. 2009 11(8) 934-42 
[ PubMed ID = 19620970 ] [ RRC reference ]

Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W.
Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins.
Genetics 2007 177(2) 1221-6 
[ PubMed ID = 17720937 ] [ RRC reference ]

Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet. 2013 9(8) e1003679 
[ PubMed ID = 23990794 ] [ RRC reference ]

Kim S, Govindan JA, Tu ZJ, Greenstein D.
SACY-1 DEAD-Box helicase links the somatic control of oocyte meiotic maturation to the sperm-to-oocyte switch and gamete maintenance in Caenorhabditis elegans.
Genetics 2012 192(3) 905-28 
[ PubMed ID = 22887816 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev. Cell 2015 35(2) 247-61 
[ PubMed ID = 26506311 ] [ RRC reference ]

Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]