Mutants (Isolated)

tm592

Allele Nametm592
Sequence NameF57C9.4
CGC NameF57C9.4
Worm BaseAllele Name tm592
CGC Name F57C9.4
Sequence F57C9.4
Phenotypehomozygous viable. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior.
Mutation site13135/13136-14085/14086 (950 bp deletion)
ChromosomeI
Putative gene structurejoin(8317..8433, 8487..8777, 8823..8900, 9410..9689, 10006..10173, 10222..10322, 10371..10484, 10531..10782, 10826..10937, 10989..11061, 11111..11218, 11647..11820, 11868..11911, 12125..12211, 12259..12577, 13032..13122, 13545..13706)
Map position-0.72
Balancer
Map position of balancer
Sequence of primersExtFwd:GCATGCGAGCATTGCGGCAA,IntFwd:CAAACGAGGACGTCGGAATT,IntRev:CAATCTACAGATGAGTGCGT,ExtRev:TGTGAAAACCCTGAGAGCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Barrett A, Hermann GJ.
A Caenorhabditis elegans Homologue of LYST Functions in Endosome and Lysosome-Related Organelle Biogenesis.
Traffic 2016 17(5) 515-35 
[ PubMed ID = 26822177 ] [ RRC reference ]

Sato K, Norris A, Sato M, Grant BD.
C. elegans as a model for membrane traffic.
WormBook 2014  1-47 
[ PubMed ID = 24778088 ] [ RRC reference ]

Morris C, Foster OK, Handa S, Peloza K, Voss L, Somhegyi H, Jian Y, Vo MV, Harp M, Rambo FM, Yang C, Hermann GJ.
Function and regulation of the Caenorhabditis elegans Rab32 family member GLO-1 in lysosome-related organelle biogenesis.
PLoS Genet 2018 14(11) e1007772 
[ PubMed ID = 30419011 ] [ RRC reference ]

Hermann GJ, Scavarda E, Weis AM, Saxton DS, Thomas LL, Salesky R, Somhegyi H, Curtin TP, Barrett A, Foster OK, Vine A, Erlich K, Kwan E, Rabbitts BM, Warren K.
C. elegans BLOC-1 functions in trafficking to lysosome-related gut granules.
PLoS One 2012 7(8) e43043 
[ PubMed ID = 22916203 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol Biol Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]