Allele Name | tm592 |
Allele Type | Normal |
Sequence Name | F57C9.4 |
Gene Name | WBGene00019011 |
Worm Base | Allele Name |
tm592
|
Gene Name |
WBGene00019011
|
Sequence |
F57C9.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 13135/13136-14085/14086 (950 bp deletion) |
Chromosome | I |
Putative gene structure | join(8317..8433, 8487..8777, 8823..8900, 9410..9689, 10006..10173, 10222..10322, 10371..10484, 10531..10782, 10826..10937, 10989..11061, 11111..11218, 11647..11820, 11868..11911, 12125..12211, 12259..12577, 13032..13122, 13545..13706) |
Map position | -0.72 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GCATGCGAGCATTGCGGCAA,IntFwd:CAAACGAGGACGTCGGAATT,IntRev:CAATCTACAGATGAGTGCGT,ExtRev:TGTGAAAACCCTGAGAGCCA |
Distributed lab | Dr. Abby Dernburg(2004/7),Dr. Greg Hermann(2008/11),Dr. M. Zetka(2007/1),Dr. Falk Butter(2020/3),Dr. Antony Page(2021/2),Dr. Dominique Glauser(2024/2) |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Morris C, Foster OK, Handa S, Peloza K, Voss L, Somhegyi H, Jian Y, Vo MV, Harp M, Rambo FM, Yang C, Hermann GJ. Function and regulation of the Caenorhabditis elegans Rab32 family member GLO-1 in lysosome-related organelle biogenesis. PLoS Genet 2018 14(11) e1007772
[ PubMed ID = 30419011 ]
[ RRC reference ]
|
Barrett A, Hermann GJ. A Caenorhabditis elegans Homologue of LYST Functions in Endosome and Lysosome-Related Organelle Biogenesis. Traffic 2016 17(5) 515-35
[ PubMed ID = 26822177 ]
[ RRC reference ]
|
Hermann GJ, Scavarda E, Weis AM, Saxton DS, Thomas LL, Salesky R, Somhegyi H, Curtin TP, Barrett A, Foster OK, Vine A, Erlich K, Kwan E, Rabbitts BM, Warren K. C. elegans BLOC-1 functions in trafficking to lysosome-related gut granules. PLoS One 2012 7(8) e43043
[ PubMed ID = 22916203 ]
[ RRC reference ]
|
Sato K, Norris A, Sato M, Grant BD. C. elegans as a model for membrane traffic. WormBook 2014 1-47
[ PubMed ID = 24778088 ]
[ RRC reference ]
|
Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ. Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1. Mol Biol Cell 2014 25(7) 1073-96
[ PubMed ID = 24501423 ]
[ RRC reference ]
|
|