Mutants (Isolated)

tm5782

Allele Nametm5782
Sequence NameT05D4.1
CGC Namealdo-1
Worm BaseAllele Name tm5782
CGC Name aldo-1
Sequence T05D4.1
Phenotypehomozygous viable.
Mutation site9904/9905-G-10239/10240 (335 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(9359..9886, 10126..10601, 10702..10795))
Map position21.27
Balancer
Map position of balancer
Sequence of primersIntFwd:CGACGAAGAGGGATTGGGAA,ExtFwd:AGAGATCCTGAGCGTGGCCA,IntRev:CTGCACGGCTTCTCACACAC,ExtRev:AGGGCCCCTCAATTCCCTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]