Mutants (Isolated)

tm5782

Allele Nametm5782
BalanceNot Required
OutCrossNot Accepted
Sequence NameT05D4.1
Gene Namealdo-1
Worm BaseAllele Name tm5782
Gene Name aldo-1
Sequence T05D4.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9904/9905-G-10239/10240 (335 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(9359..9886, 10126..10601, 10702..10795))
Map position21.27
Balancer
Map position of balancer
Sequence of primersIntFwd:CGACGAAGAGGGATTGGGAA,ExtFwd:AGAGATCCTGAGCGTGGCCA,IntRev:CTGCACGGCTTCTCACACAC,ExtRev:AGGGCCCCTCAATTCCCTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]

Jang S, Nelson JC, Bend EG, Rodríguez-Laureano L, Tueros FG, Cartagenova L, Underwood K, Jorgensen EM, Colón-Ramos DA.
Glycolytic Enzymes Localize to Synapses under Energy Stress to Support Synaptic Function.
Neuron 2016 90(2) 278-91 
[ PubMed ID = 27068791 ] [ RRC reference ]

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ.
SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat.
Genes Dev 2015 29(23) 2490-503 
[ PubMed ID = 26637528 ] [ RRC reference ]