Mutants (Isolated)

tm5771

Allele Nametm5771
Sequence NameY92H12A.2
CGC NameY92H12A.2
Worm BaseAllele Name tm5771
CGC Name Y92H12A.2
Sequence Y92H12A.2
Phenotypehomozygous viable.
Mutation site54510/54511-55091/55092 (581 bp deletion)
ChromosomeI
Putative gene structurejoin(54573..54620, 54764..54913, 55225..55430, 55701..55904, 56571..56703, 61291..61668, 62939..63052, 63643..63788, 64456..64822, 65737..66062, 66727..66829)
Map position-14.59
Balancer
Map position of balancer
Sequence of primersIntRev:CTTTCCGGCGGTGTGAACTG,IntFwd:GCACTCCAATGAAGCTGTGT,ExtRev:CCCAAAGCTATGCAGTTAAC,ExtFwd:GGAAGGTCAGAACCCCATCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen X, Chalfie M.
Regulation of mechanosensation in C. elegans through ubiquitination of the MEC-4 mechanotransduction channel.
J Neurosci 2015 35(5) 2200-12 
[ PubMed ID = 25653375 ] [ RRC reference ]