Mutants (Isolated)

tm572

Allele Nametm572
Sequence NameT05A10.1
CGC Namesma-9
Worm BaseAllele Name tm572
CGC Name sma-9
Sequence T05A10.1
Phenotypehomozygous viable. Dr. J. Liu: Development 133, 2887-2896 (2006).
Mutation site8260/8261-9047/9048 (787 bp deletion )
ChromosomeX
Putative gene structurejoin(34443..35006, 35059..35214, 35283..35820, 8271..8680, 8729..8866, 9014..9232, 9281..10803, 10877..10981, 11184..11304, 11351..11448, 11502..11617, 11703..11811, 11863..12083, 12130..12287, 12337..12612, 12669..12817, 12906..13048, 13337..13800, 13939..14039, 14087..14330, 14381..14522, 14574..14710, 14759..15414)
Map position2.52
Balancer
Map position of balancer
Sequence of primersExtFwd:TCCGCTATACCGTCTCGATT,IntRev:GATTACCAGCCAGTATGGTT,ExtRev:AAGGACGCCCTCCAATGTCA,IntFwd:TTGCATGCCAGTGCGTGTCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zhuang JJ, Banse SA, Hunter CP.
The nuclear argonaute NRDE-3 contributes to transitive RNAi in Caenorhabditis elegans.
Genetics 2013 194(1) 117-31 
[ PubMed ID = 23457236 ] [ RRC reference ]

Foehr ML, Lindy AS, Fairbank RC, Amin NM, Xu M, Yanowitz J, Fire AZ, Liu J.
An antagonistic role for the C. elegans Schnurri homolog SMA-9 in modulating TGFbeta signaling during mesodermal patterning.
Development 2006 133(15) 2887-96 
[ PubMed ID = 16790477 ] [ RRC reference ]