Mutants (Isolated)

tm5597

Allele Nametm5597
Sequence NameF35B3.5
CGC Nameptrn-1
Worm BaseAllele Name tm5597
CGC Name ptrn-1
Sequence F35B3.5
Phenotypehomozygous viable.
Mutation site19328/19329-19921/19922 (593 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(13705..13846, 13896..13972, 14020..14115, 14421..14530, 14883..15279, 15327..15457, 15508..15586, 15694..15882, 15954..16169, 16567..16773, 16898..17121, 17683..17909, 18068..18189, 18572..18852, 18909..19057, 19110..19170, 19358..19578, 19871..19956, 20470..20583, 20635..20736, 20996..21097, 21583..21636))
Map position24.07
Balancer
Map position of balancer
Sequence of primersIntRev:AGTCTGCACACCTTGCAATA,ExtFwd:AGTTCGAGAACGTGTAGTGC,IntFwd:CGTGTAGTGCAGAATTCTCG,ExtRev:GGAAGGATATACACAAGTACCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Borgen MA, Giles AC, Wang D, Grill B.
Synapse maintenance is impacted by ATAT-2 tubulin acetyltransferase activity and the RPM-1 signaling hub.
Elife 2019 8  
[ PubMed ID = 30652969 ] [ RRC reference ]

Gong T, Yan Y, Zhang J, Liu S, Liu H, Gao J, Zhou X, Chen J, Shi A.
PTRN-1/CAMSAP promotes CYK-1/formin-dependent actin polymerization during endocytic recycling.
EMBO J. 2018 37(9)  
[ PubMed ID = 29567645 ] [ RRC reference ]

Borgen MA, Wang D, Grill B.
RPM-1 regulates axon termination by affecting growth cone collapse and microtubule stability.
Development 2017 144(24) 4658-4672 
[ PubMed ID = 29084805 ] [ RRC reference ]

Richardson CE, Spilker KA, Cueva JG, Perrino J, Goodman MB, Shen K.
PTRN-1, a microtubule minus end-binding CAMSAP homolog, promotes microtubule function in Caenorhabditis elegans neurons.
Elife 2014 3 e01498 
[ PubMed ID = 24569477 ] [ RRC reference ]

Marcette JD, Chen JJ, Nonet ML.
The Caenorhabditis elegans microtubule minus-end binding homolog PTRN-1 stabilizes synapses and neurites.
Elife 2014 3 e01637 
[ PubMed ID = 24569480 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83 
[ PubMed ID = 25437544 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]