Mutants (Isolated)

tm5487

Allele Nametm5487
Sequence NameT21C12.1
CGC Nameunc-49
Worm BaseAllele Name tm5487
CGC Name unc-49
Sequence T21C12.1
Phenotypehomozygous viable.
Mutation site7917/7918-8219/8220 (302 bp deletion)
ChromosomeIII
Putative gene structurejoin(293..366, 1372..1458, 2047..2122, 2241..2482, 3568..3686, 4199..4330, 4598..4797, 5218..5266, 6246..6345, 6432..6624, 6713..6791, 7262..7444, 7695..7950, 8002..8161, 8663..8698, 8757..8887, 9060..9478, 9911..10063, 10554..10657, 10704..10989, 11534..11664, 11768..11878)
Map position3.35
Balancer
Map position of balancer
Sequence of primersIntRev:TTCTAATGAAGACTCGGGTG,IntFwd:CGGCTACTGGGCCTACTTCA,ExtRev:CGCCTCGATTGAGAAAACTC,ExtFwd:TTCTACCGTACCGTCCGTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Deng L, Denham JE, Arya C, Yuval O, Cohen N, Haspel G.
Inhibition Underlies Fast Undulatory Locomotion in Caenorhabditis elegans.
eNeuro 2021 8(2)  
[ PubMed ID = 33361147 ] [ RRC reference ]